IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/07

From OpenWetWare

Jump to: navigation, search
iGEM iGarden Main project page
Previous entry      Next entry

Team Allergy

Yesterday, we ended by transforming pKannabil and pHannibal into E. coli and running a diagnostic digest of digested allergen panel. Yesterday's plates did not grow, and the diagnostic digest did not have good results.

  • Today, we will be redoing diagnostic digests of the allergen panel plasmids to see if we can see our desired bands (300 bp and 3200) and re-transforming pKannabil and pHannibal.
    • If the digested allergen panel runs correctly on a gel, then we will send the plasmids off for sequencing.
    • If nothing gel does not run correctly, then we will go back to re-digest V0120 with a death gene insert instead of YFP and ligate allergen inserts, transform, miniprep, and see if we get the correct insert. **If some run correctly and some did not, we will collect more samples from our culture plates for the allergens that did not work and redo the digests until we find a sample with the correct plasmid.
  • If the pKannabil and pHannibal plates grow, then we will miniprep to purify the plasmids containing the PDK intron, PCR the intron, and purify the intron.
  • Today, we are also running the PDK intron obtained yesterday to see if it is the correct length.

First thing tomorrow, we will culture E. coli containing plasmids for our allergen panel to obtain more plasmids.

Procedures

For pKannabil and pHannibal:

  1. Electronic Gel Electrophoresis of PDK introns (from PCR reaction yesterday, PCR off DNA from the eluted vectors)
  2. Re-grow E. coli containing pKannabil and pHannibal plasmids
  3. Culture colonies
  4. Miniprep colonies
  5. PCR for PDK intron
  6. Diagnostic Gel to check for correct length
  7. Repeat PCR of PDK intron using different Tm (gradient pcr)

For Allergen panel

  1. Digest of Plasmids containing allergen inserts
  2. Diagnostic Gel
  3. Collect additional samples for allergens that did not work


Results

For pKannabil and pHannibal

Transformation of pHannibal pKannibal

This transformation we performed slightly differently from the one yesterday. This protocol is nicknamed the "quick and dirty transform." The transformation we started yesterday of pH and pK didn't work (no growth on either plate).

Quick and Dirty Transform:

  1. Mix
    1. 2ul 10x {pHannibal, pKannibal}
    2. 20ul Turbo E. Coli
    3. 220ul SOC Broth
  2. Plate on {LB+(pHannibal->LB+Amp, pKannibal->LB+Kan), LB} Agar, grow

PCR of PDK intron

  • PCR of PME3 and PAL2
    • saw no bands from last night's pcr so we re ran it

Annealing Temp: 69C Extension Time: 30 sec

2 reactions

Name Amount (uL)
10mM dNTPs 1
5x Phusion Buffer 10
Phusion Polymerase .5
Arabadopsis Genomic DNA 7 ng
Fwd/Rev Primer .5 uM each (1uL 50x)
Water 35.5

Concentrations: PDK:46.5 ng/uL & 36.5 ng/uL Didn't work. Our theory is that the Tm we used (the one IDT sent us) was too high. IDT assumes that the entire primer is going to anneal to a strand of DNA when they calculate their Tm, but since half of our primer won't anneal (the half that doesn't anneal was used to prepend/postpend the biobrick sequences) the Tm IDT calculates will be too high. Here are more correct calculations from Primer3:

OLIGO            start  len      tm     gc%   any    3' seq 

LEFT PRIMER       4229   20   51.11   30.00  8.00  3.00 CCAATTGGTAAGGAAATAAT
RIGHT PRIMER      5021   20   61.95   45.00  6.00  0.00 TTCGAACCCAATTTCCCAAC


See Gel Image Below: ladder, lane 3 and 5 are pdk intron


lanes 3 and 5 correspond to the pdk intron


Gradient PCR

Annealing Temps: 50,55,60,65

Extension Time: 30 sec

8 reactions

Name Amount (uL)
10mM dNTPs 1
5x Phusion Buffer 10
Phusion Polymerase .5
Arabadopsis Genomic DNA 7 ng
Fwd/Rev Primer .5 uM each (1uL 50x)
Water 35.5


Concentrations: PDK: 12.7 ng/uL

Remaining steps

  1. Culture colonies
  2. Miniprep colonies
  3. PCR for PDK intron
  4. Diagnostic Gel to check for correct length
  5. Repeat PCR of PDK intron using different Tm.

For Allergen panel

Digest of Plasmids containing allergen inserts

Digested with Xba and Pst using Fast Fermentas digest protocol. Added 3 μL of DNA and 17μL of master mix (with 0.5μL of each restriction enzyme) to each reaction.

Diagnostic Digest

    • Digestions
Digestion Reactions
LTPS (3) LTPA (3) GRES (3)GREA (3) Bet1SBet1ABet1.2S Bet1.2A
DNA (~200 ng) (~200 ng)|align="center" | (~200 ng)|align="center" | (~200 ng)|
FD Buffer (10x) 2 2 2 2
diH2O x x x x
Xba1 1 1 1 1
Pst1 1 1 1 1
    • Ran on a gel

Image:Insert image

Out of the 24 lanes, 6 were successful. Of the 8 allergens, 3 were successful. Samples of LTP sense, Betv1 sense, and Ger sense had one band at around 3kbps and one band at 300bps. The other genes had one band at 3kbps and additional longer bands on the scale of twice or three times the length of the plasmid.

For the allergens that did not work, we will go back to our bacteria plates and sample 5 additional colonies for each allergen, grow up 10 mL overnight cultures, and miniprep so that we can redo the diagnostic digest. We are hoping that a larger sample size would allow us to find colonies with the correct plasmid.

Remaining Steps

  1. Collect additional samples for allergens that did not work
  2. Culture them
  3. Miniprep
  4. Diagnostic Digest and Gel

Team Fence

Miniprep of Barastar and NLS Ligation products

Performed miniprep of overnight cell cultures of 7 colonies of Barstar, 3 colonies of NLS.

Minipreps performed according to pages 22-23 of the QIAprep Miniprep Handbook.

Digestion of Barstar and NLS Ligation products

7 reactions of Barstar and 3 reactions of NLS

In each reaction:

  • 1μL Xba1
  • 1μL Pst1
  • 2.5μL of sample, Barstar or NLS Plasmid, respectively, obtained from miniprep (above)
  • 2μL Buffer
  • 13.5μL DH2O

Ran on a 2% agarose E-gel

Lane 1: Ladder

Lane 2-8: Barstar

Lane 9-11: NLS


PCR of LacIN

3 reactions, each with:

  • 1μL Fwd LacIN Primer
  • 1μL Rev LacIN Primer
  • .5μL Polymerase
  • 2μL DNTP
  • 4μL Buffer
  • 1μL E10 Plasmid (LacI)
  • 10.5μL DH2O

Using program:

1= 95°C for 10:10

2= 95°C for :15

3= 50°C for :30

4= 72°C for 1:30

5= goto 2, 29 times

6=72°C for 10:10

7=4°C forever

Gel Image of LacIN PCR result:


PCR of Barnase and Gal4DBD

5 reactions each of Barnase from pMT413, Barnase from pMT1002, and Gal4

In pMT413 Barnase reactions:

  • 1μL Barnase2.Fwd Primer
  • 1μL Rev.Barnase Primer
  • .5μL Polymerase
  • 2μL DNTP
  • 4μL Buffer
  • 2μL pMT413 plasmid
  • 10.5μL DH2O

In pMT1002 Barnase Reactions:

  • 1μL Barnase2.Fwd Primer
  • 1μL Rev.Barnase Primer
  • .5μL Polymerase
  • 2μL DNTP
  • 4μL Buffer
  • 2μL pMT1002 plasmid
  • 10.5μL DH2O

In Gal4DBD reactions:

  • 1μL Gal4.Fwd Primer
  • 1μL Gal4.Rev Primer
  • .5μL Polymerase
  • 2μL DNTP
  • 4μL Buffer
  • 2μL Gal4DBD plasmid
  • 10.5μL DH2O

Team Flavor

  • Can he handle the flavor? Chew on that question.

Sequencing

V0120 Plasmids containing the pENTCUP2 plant promoter, NOS terminator and NOS terminator + STOP were sent to GENEWIZ for sequencing. Sequencing results are expected tomorrow.

Sequencing Order


Cultures

5 mL cultures were started from the YFP-2x construct from yesterday, as well as the B15 (StrepII) tag.

  • 2 x B21 E/X + Brazz E/S - C-Terminus
  • 2 x B21 S/P + Brazz X/P - N-Terminus
  • 2 x B21 E/X + Mira E/S - C-Terminus
  • 2 x B21 S/P + Mira X/P - N-Terminus
  • 2 x B15 Plate #1
  • 2 x B15 Plate #2

Cultures were placed in a 37°C incubator and left to shake overnight.


Primers for Wintergreen pathway parts

J45004

  • Left Primer: 5' cctttctagaatggaagttgttgaagttcttca 3'
  • Right Primer: 5' aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum)

J45017

  • Left Primer: 5' cctttctagaatgaaaactcccgaagactgc 3'
  • Right Primer: 5' aaggctgcagcggccgctactagtttattaggcgacgccgc 3'



Personal tools