BME100 s2015:Group13 12pmL4: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 16: Line 16:
| [[Image:Tina Monteilh.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Tina Monteilh.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Trisha Dasgupta.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Trisha Dasgupta.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:RileyBaranek.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Riley.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Payson Wallach.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Payson Wallach.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Robel Okbe.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:Robel Okbe.jpg|100px|thumb|Name: student<br>Role(s)]]

Revision as of 16:39, 30 March 2015

BME 100 Spring 2015 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


OUR TEAM

File:Tina Monteilh.jpg
Name: student
Role(s)
Name: student
Role(s)
Name: student
Role(s)
File:Payson Wallach.jpg
Name: student
Role(s)
Name: student
Role(s)

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 μL each: Mix contains Taq DNA polymerase, MgCl2, and dNTP’s

(http://www.promega.com/resources/protocols/product-information-sheets/g/gotaqcolorless-master-mix-m714-protocol/)

  • DNA/ primer mix, 8 tubes, 50 μL each: Each mix contains a different template DNA. All tubes

have the same forward primer and reverse primer

  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never re-use disposable pipette tips or

samples will be cross-contaminated

  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G13 + Positive control none
G13 - Negative control none
G13 1-1 Patient 1, replicate 1 21533
G13 1-2 Patient 1, replicate 2 21533
G13 1-3 Patient 1, replicate 3 21533
G13 2-1 Patient 2, replicate 1 45821
G13 2-2 Patient 2, replicate 2 45821
G13 2-3 Patient 2, replicate 3 45821


DNA Sample Set-up Procedure

  1. Step 1
  2. Step 2
  3. Step 3...


OpenPCR program HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 35
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C






Research and Development

PCR - The Underlying Technology
Q1
Template DNA is used to make the complementary strand. Primers are used to help copy the DNA by attaching to sites on the DNA strands that are at either end of the segment that needs to be copied. Taq polymeraseis an enzyme that assembles new DNA from nucleotides. Deoxyribonucleotides (dNTPs) are the building blocks from which the DNA polymerase (Taq polymerase) uses to make the new DNA strand.
Q2
Initial step: 95 degrees Celsius for 3 minutes- Heats up all of the components
Denature at 95 degrees Celsius for 30 seconds-The template DNA experiences DNA melting which makes single-stranded DNA
Anneal at 57 degrees Celsius for 30 seconds- allows the primers to attach to the single stranded DNA template
Extend at 72 degrees Celsius for 30 seconds- Taq polymerase is at is optimum activity level at this temperature. The taq polymerase is able to assemble a new strand of DNA along with a complementary strand using the deoxyribonucleotides.
FINAL STEP-72 degrees Celsius for 3 minutes- this makes sure that all of the single-stranded DNA was extended.
FINAL HOLD: 4 degrees Celsius-used for short-term storage of the reaction.
Q3
Adenine pairs with Thymine while Cytosine pairs with Guanine.
Q4
What is a nucleotide? The organic base units of DNA and RNA What is a polymorphism? A point mutation that is expressed in multiple forms within a population. What species is this variation found in? (latin name) HomoSapien What chromosome is the variation located on? chromosome 8 What is listed as the Clinical significance of this SNP? It is contained within a pathogenic allele Which gene(s) is this SNP associated with? LPL (Lipoprotein Lipase) Click the PubMed link to view summaries of research associated with the SNP. What disease is linked to this SNP? Coronary heart disease What does LPL stand for? Lipoprotein Lipase What is the function of LPL? To find out, click the LPL link. Look for “Gene ontology” in the right hand list and click it. Write the first three unique terms you see... 1.Apo lipoprotein binding 2.heparin binding 3.lipoprotein lipase activity What is an allele? A variation in a gene. The disease-associated allele contains what sequence? The sequence aat. The numerical position of the SNP is 19956018 Non-disease forward primer (20 nt): aatctgggctatgagatcaa The numerical position exactly 200 bases to the right of the disease SNP is: 19956218 Non-disease reverse primer (20 nt): gaaacaccagggctcagggt Disease forward primer (20 nt): aatctgggctatgagatcag Disease reverse primer (20 nt): gaaacaccagggctcagggt Primer Design and Testing .