840:153g:Projects/project4/2009/03/12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 12: Line 12:


     Forward Primer:
     Forward Primer:
         5’ [ATGAATTCGCGGCCGCTTCTAG]ATGGGTTTAGGTAAGAAATT
         5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGGTTTAGGTAAGAAATT


     Reverse Primer:
     Reverse Primer:
Line 19: Line 19:
*The following primers will be used to clone just the '''mature''' product of the protease gene
*The following primers will be used to clone just the '''mature''' product of the protease gene


     Forward Primer:
     Forward Primer Mature:
         5’ [ATGAATTCGCGGCCGCTTCTAG]ATGGCCGCCGCCACTGGAA
         5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGCCGCCGCCACTGGAA


     Reverse Primer:
     Reverse Primer:
         5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA
         5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA
*The following mutated primer will be used if the previous forward primer doesn't work
    Forward Primer Mature C-A mutated:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGC(A)GCCGCCACTGGAA




Revision as of 14:44, 12 March 2009

Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Thursday 3/12

Oggie

  • Designed primers for neutral protease gene of B. subtilis strain 168
  • Gene will be used to test the extracted DNA's and as a backup if aprE (alkaline protease subtilisin) can't be cloned again
  • The following primers will be used to clone the entire protease gene
   Forward Primer:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGGTTTAGGTAAGAAATT

   Reverse Primer:
        5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA
  • The following primers will be used to clone just the mature product of the protease gene
   Forward Primer Mature:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGCCGCCGCCACTGGAA

   Reverse Primer:
        5’ [ATCTGCAGCGGCCGCTACTAGTA]TTACAATCCAACAGCATTCCA
  • The following mutated primer will be used if the previous forward primer doesn't work
   Forward Primer Mature C-A mutated:
        5’ [TAGAATTCGCGGCCGCTTCTAG]ATGGC(A)GCCGCCACTGGAA


Josh and Casy

  • Used two liquid cultures of the Bacillus subtilis for genomic DNA extraction, following the protocol from Bionet.
  • Stored the four DNA samples at room temperature in isopropanol.
  • After break, the DNA will be run on a gel to determine if it is ready for use in the aprE gene amplification.
Retrieved from "https://openwetware.org/mediawiki/index.php?title=840:153g:Projects/project4/2009/03/12&oldid=293355"