Wilfred J. Poppinga/Notebook/Wilfreds Project/2009/07/28/ZntR+RBS REV

From OpenWetWare
Jump to: navigation, search

Sequence ZntR+RBS Reverse oligo

5'- CTAGTATCCTCCGGTTAAGTTTTTTCTCATTAACCGAAGGATACACTCTGGAGTCGACTCCAGAGTCAAGTTTTATCAGAGATACAGCGAGCGGACGCTCTAGAAGCGGCCGCG - 3'