Van Oudenaarden Lab:Y105C5B.29

From OpenWetWare
Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>Y105C5B.29 (spliced + UTR - 419) ATGGAGAAAA TGAGCAGCGA TCTAACTTTT GCGGAGCCGG GAGTTCGACT TTCTATTAAT TTGAGGGAAA GATGCCGAAT GCATGACTTA AACGAGGCAC TTGACGATCT GCGAGCTGTA ATTCCATATG CTCACGGGGG CTCTGTGAGG AAATTGAGCA AGATTGCCAC GTTGCTTTTG GCCAAGAACC ATATAATTAT GCAGGCAAAA GCAATCGAAG AGCTAAGTGT TCTGGTGTCC CAGTTGAAAA CCAGGAAATC TTCTGGAAAT TCGGAAAATT TGGAGAAAAC CGTGTCAACA CCATCCGAAG GAGATTAGcg ctggtgatag attcctggat gttcaacaaa ttgatgttgc aaaaaaatta cacattttta ccgtttcaga tatattttat gcctataata aagcaactg


Name of probe set: hlh-32 Probes designed on Wed, 03 Mar 10 23:25:16 -0700 19 probes designed for target of length 419 (target too short for 42 probes)

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

tcgctgctcattttctccat, hlh-32_1, 1, 1, 45 tcccggctccgcaaaagtta, hlh-32_2, 2, 23, 55 tcaaattaatagaaagtcga, hlh-32_3, 3, 45, 25 tcatgcattcggcatctttc, hlh-32_4, 4, 67, 45 atcgtcaagtgcctcgttta, hlh-32_5, 5, 89, 45 catatggaattacagctcgc, hlh-32_6, 6, 111, 45 ttcctcacagagcccccgtg, hlh-32_7, 7, 133, 65 caacgtggcaatcttgctca, hlh-32_8, 8, 155, 50 ttatatggttcttggccaaa, hlh-32_9, 9, 177, 35 tcgattgcttttgcctgcat, hlh-32_10, 10, 199, 45 ggacaccagaacacttagct, hlh-32_11, 11, 221, 50 aagatttcctggttttcaac, hlh-32_12, 12, 243, 35 tccaaattttccgaatttcc, hlh-32_13, 13, 265, 35 ggatggtgttgacacggttt, hlh-32_14, 14, 287, 50 atcaccagcgctaatctcct, hlh-32_15, 15, 309, 50 tttgttgaacatccaggaat, hlh-32_16, 16, 331, 35 tgtaatttttttgcaacatc, hlh-32_17, 17, 353, 25 tatatctgaaacggtaaaaa, hlh-32_18, 18, 375, 25 ttgctttattataggcataa, hlh-32_19, 19, 397, 25


Input sequence with probe locations:


atggagaaaatgagcagcgatctaacttttgcggagccgggagttcgactttctattaatttgagggaaa tacctcttttactcgtcgct attgaaaacgcctcggccct agctgaaagataattaaact cttt Probe # 1, 45% GC Probe # 2, 55% GC Probe # 3, 25% GC Prob

gatgccgaatgcatgacttaaacgaggcacttgacgatctgcgagctgtaattccatatgctcacggggg ctacggcttacgtact atttgctccgtgaactgcta cgctcgacattaaggtatac gtgccccc e # 4, 45% GC Probe # 5, 45% GC Probe # 6, 45% GC Probe #

ctctgtgaggaaattgagcaagattgccacgttgcttttggccaagaaccatataattatgcaggcaaaa gagacactcctt actcgttctaacggtgcaac aaaccggttcttggtatatt tacgtccgtttt 7, 65% GC Probe # 8, 50% GC Probe # 9, 35% GC Probe # 10,

gcaatcgaagagctaagtgttctggtgtcccagttgaaaaccaggaaatcttctggaaattcggaaaatt cgttagct tcgattcacaagaccacagg caacttttggtcctttagaa cctttaagccttttaa 45% GC Probe # 11, 50% GC Probe # 12, 35% GC Probe # 13, 35%

tggagaaaaccgtgtcaacaccatccgaaggagattagcgctggtgatagattcctggatgttcaacaaa acct tttggcacagttgtggtagg tcctctaatcgcgaccacta taaggacctacaagttgttt GC Probe # 14, 50% GC Probe # 15, 50% GC Probe # 16, 35% GC

ttgatgttgcaaaaaaattacacatttttaccgtttcagatatattttatgcctataataaagcaactg

 ctacaacgtttttttaatgt  aaaaatggcaaagtctatat  aatacggatattatttcgtt   
 Probe # 17, 25% GC    Probe # 18, 25% GC    Probe # 19, 25% GC