Van Oudenaarden Lab:W02C12.3

From OpenWetWare
Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>W02C12.3a (spliced + UTR - 1558) cagcaattca tacacaattg atcgtccccg tccatataac cgctgaaaaa aaggaaaaaa aATGGCCGAT GACGACGACC GCGTTGACAT TTCCAACGAG ACGCTTGCCT CTTTGGTGGG TCGACCGATG AGCTCGTCGG GCAATCGGAT TCGAGCCACC CCATCCAGAC GGCGGCTGGT TTCTGCGCCG ACGAACCCGA GGTGGTCACC ATCCGCAGAC GATCGGCGTC TTTTTTCATA TGTCTCGTCG ATGCGGTCGG ATAGTAACAG TAGCAGCAAG TCACCATCTC CACCGTCGGC CAAAATGTCT AAAAGGCCGA ATGGCCCGTA CTCTGTTAGA AAATATCAGC CCCGCGGATC CCCACCCAGT GACGGCAGCG ACAAAATTCA CAGATTCGGA GAGAGCCCAA CGCCCGGTGG TGTCGGTGGT GTATTTGGCA CAGAGCTTGA CGACCTGATC ATTGATGAGC TCATGGGCAT GGAAGATGAT CAGCGAATGC GTCCAGGAGC GACACGACCG ATGACGATTG GTGGAGAAAA AACCATGTCG ATGGCAAGAC CGATTCCAGG CGCCAGCTCC CGGGCTGGCT CAGGACACTC TGGAAGCCCG ATCACAATTC CAAACGCAAT GTCGAACAAT TTCAGACAGG TCGTCTCAAG TTCGGCGCCG ACGAGTTCGA TCGACATTGA GAAGATGATT GGCGCCGTGT CGAACGGCGG TGGGAATAGT GGCGGTGATA ATGATCCGGA GGACTATTAC CGCGACCGCA GGAAGAAGGA CATTCACAAT ATGATTGAAC GCCGACGAAG ATATAATATA AATGACAGGA TTAAGGAGCT CGGACAAATG TTGCCGAAGA ACACATCAGA AGACATGAAA CTCAACAAAG GAACAATTCT AAAAGCCTCG TGTGACTACA TCCGAGTGCT CCAAAAAGAT CGCGAGCAAG CGATGAAAAC CCAACAGCAG CAGAAATCGC TGGAATCGAC GGCTCACAAG TACGCCGACC GGGTGAAAGA GCTCGAGGAG ATGCTCGCCA GGCAGGGAGT GCAGGTCCCG CCATCGCATC TTCCACCGAT CCCGAAAGTG ATCGAGCGAC CGATTAAGCA GGAAATCGAC GAGTCGCCAC CAAATCACAC GCCGACCGGA TCGTTTGTGT CCTCATCCGG CTTCCTATCC GAGGTGACAA ACAACACCGC CGCCATGCAG ATCACATCGC CGAACGACTC GCGCCCGAAC AACTTCATGA ACAACTCGGC GCCGTCGGAC AGCTTCTTCT CGGTCGGATC GGCTAGCCCG CCAGATTATA GGACGAGCAG CGGCACCGCG TCGTGGAAGC TGCCCGGATC GAACGCCTTC TCCGACCTCA TGATGGACGA TCTCAACCCA ATGATGAACG GCGATCCACT CATCTCATCG GCCGGCGCTC ATCCATCACC ACACTTCCAC AGCTCACAAA TGTCACCAGA CATTCATTGG GACGCCTCTG GCTTCTCCCC AGACCCGATC AACACCCAAC AGTCAAACTC GGGTCATTAT CACATGGACT TTTCGTAA


Name of probe set: hlh-30 Probes designed on Wed, 03 Mar 10 23:37:47 -0700 42 probes designed for target of length 1497

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

tctcgttggaaatgtcaacg, hlh-30_1, 1, 21, 45 aaaaagacgccgatcgtctg, hlh-30_2, 2, 155, 50 accgcatcgacgagacatat, hlh-30_3, 3, 177, 50 gacttgctgctactgttact, hlh-30_4, 4, 202, 45 tttagacattttggccgacg, hlh-30_5, 5, 233, 45 ttttctaacagagtacgggc, hlh-30_6, 6, 263, 45 tctgtgaattttgtcgctgc, hlh-30_7, 7, 314, 45 aaatacaccaccgacaccac, hlh-30_8, 8, 356, 50 atcaggtcgtcaagctctgt, hlh-30_9, 9, 379, 50 catgcccatgagctcatcaa, hlh-30_10, 10, 401, 50 gacgcattcgctgatcatct, hlh-30_11, 11, 423, 50 tttctccaccaatcgtcatc, hlh-30_12, 12, 459, 45 atcggtcttgccatcgacat, hlh-30_13, 13, 484, 50 attgtgatcgggcttccaga, hlh-30_14, 14, 538, 50 attgttcgacattgcgtttg, hlh-30_15, 15, 560, 40 aacttgagacgacctgtctg, hlh-30_16, 16, 582, 50 tcaatgtcgatcgaactcgt, hlh-30_17, 17, 610, 45 attatcaccgccactattcc, hlh-30_18, 18, 662, 45 tgtgaatgtccttcttcctg, hlh-30_19, 19, 708, 45 tatcttcgtcggcgttcaat, hlh-30_20, 20, 733, 45 gagctccttaatcctgtcat, hlh-30_21, 21, 761, 45 gtgttcttcggcaacatttg, hlh-30_22, 22, 784, 45 gttgagtttcatgtcttctg, hlh-30_23, 23, 806, 40 gaggcttttagaattgttcc, hlh-30_24, 24, 829, 40 ttttggagcactcggatgta, hlh-30_25, 25, 856, 45 tttcatcgcttgctcgcgat, hlh-30_26, 26, 878, 50 agcgatttctgctgctgttg, hlh-30_27, 27, 901, 50 gtacttgtgagccgtcgatt, hlh-30_28, 28, 923, 50 atctcctcgagctctttcac, hlh-30_29, 29, 952, 50 tttcgggatcggtggaagat, hlh-30_30, 30, 1007, 50 atttcctgcttaatcggtcg, hlh-30_31, 31, 1036, 45 atgaggacacaaacgatccg, hlh-30_32, 32, 1086, 50 tttgtcacctcggataggaa, hlh-30_33, 33, 1111, 45 ttcggcgatgtgatctgcat, hlh-30_34, 34, 1144, 50 tgttcatgaagttgttcggg, hlh-30_35, 35, 1173, 45 tcctataatctggcgggcta, hlh-30_36, 36, 1233, 50 tccatcatgaggtcggagaa, hlh-30_37, 37, 1297, 50 cgttcatcattgggttgaga, hlh-30_38, 38, 1320, 45 tttgtgagctgtggaagtgt, hlh-30_39, 39, 1380, 45 tcccaatgaatgtctggtga, hlh-30_40, 40, 1402, 45 ttgactgttgggtgttgatc, hlh-30_41, 41, 1446, 45 tccatgtgataatgacccga, hlh-30_42, 42, 1468, 45


Input sequence with probe locations:


atggccgatgacgacgaccgcgttgacatttccaacgagacgcttgcctctttggtgggtcgaccgatga

                   gcaactgtaaaggttgctct                              
                   Probe # 1, 45% GC                                 

gctcgtcgggcaatcggattcgagccaccccatccagacggcggctggtttctgcgccgacgaacccgag


gtggtcaccatccgcagacgatcggcgtcttttttcatatgtctcgtcgatgcggtcggatagtaacagt

             gtctgctagccgcagaaaaa  tatacagagcagctacgcca     tcattgtca
             Probe # 2, 50% GC     Probe # 3, 50% GC        Probe # 4

agcagcaagtcaccatctccaccgtcggccaaaatgtctaaaaggccgaatggcccgtactctgttagaa tcgtcgttcag gcagccggttttacagattt cgggcatgagacaatctt , 45% GC Probe # 5, 45% GC Probe # 6, 45% GC

aatatcagccccgcggatccccacccagtgacggcagcgacaaaattcacagattcggagagagcccaac tt cgtcgctgttttaagtgtct

                                Probe # 7, 45% GC                    

gcccggtggtgtcggtggtgtatttggcacagagcttgacgacctgatcattgatgagctcatgggcatg

    caccacagccaccacataaa   tgtctcgaactgctggacta  aactactcgagtacccgtac
    Probe # 8, 50% GC      Probe # 9, 50% GC     Probe # 10, 50% GC  

gaagatgatcagcgaatgcgtccaggagcgacacgaccgatgacgattggtggagaaaaaaccatgtcga

 tctactagtcgcttacgcag                ctactgctaaccacctcttt     tacagct
 Probe # 11, 50% GC                  Probe # 12, 45% GC       Probe #

tggcaagaccgattccaggcgccagctcccgggctggctcaggacactctggaagcccgatcacaattcc accgttctggcta agaccttcgggctagtgtta g

13, 50% GC                                    Probe # 14, 50% GC    P

aaacgcaatgtcgaacaatttcagacaggtcgtctcaagttcggcgccgacgagttcgatcgacattgag tttgcgttacagcttgtta gtctgtccagcagagttcaa tgctcaagctagctgtaact robe # 15, 40% GC Probe # 16, 50% GC Probe # 17, 45% GC

aagatgattggcgccgtgtcgaacggcggtgggaatagtggcggtgataatgatccggaggactattacc

                              ccttatcaccgccactatta                   
                              Probe # 18, 45% GC                     

gcgaccgcaggaagaaggacattcacaatatgattgaacgccgacgaagatataatataaatgacaggat

      gtccttcttcctgtaagtgt     taacttgcggctgcttctat        tactgtccta
      Probe # 19, 45% GC       Probe # 20, 45% GC          Probe # 21

taaggagctcggacaaatgttgccgaagaacacatcagaagacatgaaactcaacaaaggaacaattcta attcctcgag gtttacaacggcttcttgtg gtcttctgtactttgagttg ccttgttaagat , 45% GC Probe # 22, 45% GC Probe # 23, 40% GC Probe # 24,

aaagcctcgtgtgactacatccgagtgctccaaaaagatcgcgagcaagcgatgaaaacccaacagcagc tttcggag atgtaggctcacgaggtttt tagcgctcgttcgctacttt gttgtcgtcg 40% GC Probe # 25, 45% GC Probe # 26, 50% GC Probe # 27

agaaatcgctggaatcgacggctcacaagtacgccgaccgggtgaaagagctcgaggagatgctcgccag tctttagcga ttagctgccgagtgttcatg cactttctcgagctcctcta , 50% GC Probe # 28, 50% GC Probe # 29, 50% GC

gcagggagtgcaggtcccgccatcgcatcttccaccgatcccgaaagtgatcgagcgaccgattaagcag

                         tagaaggtggctagggcttt         gctggctaattcgtc
                         Probe # 30, 50% GC           Probe # 31, 45%

gaaatcgacgagtcgccaccaaatcacacgccgaccggatcgtttgtgtcctcatccggcttcctatccg cttta gcctagcaaacacaggagta aaggataggc

GC                                Probe # 32, 50% GC       Probe # 33

aggtgacaaacaacaccgccgccatgcagatcacatcgccgaacgactcgcgcccgaacaacttcatgaa tccactgttt tacgtctagtgtagcggctt gggcttgttgaagtactt , 45% GC Probe # 34, 50% GC Probe # 35, 45% GC

caactcggcgccgtcggacagcttcttctcggtcggatcggctagcccgccagattataggacgagcagc gt atcgggcggtctaatatcct

                                         Probe # 36, 50% GC          

ggcaccgcgtcgtggaagctgcccggatcgaacgccttctccgacctcatgatggacgatctcaacccaa

                                   aagaggctggagtactacct   agagttgggtt
                                   Probe # 37, 50% GC     Probe # 38,

tgatgaacggcgatccactcatctcatcggccggcgctcatccatcaccacacttccacagctcacaaat actacttgc tgtgaaggtgtcgagtgttt

45% GC                                          Probe # 39, 45% GC   

gtcaccagacattcattgggacgcctctggcttctccccagacccgatcaacacccaacagtcaaactcg

agtggtctgtaagtaaccct                        ctagttgtgggttgtcagtt  agc
Probe # 40, 45% GC                          Probe # 41, 45% GC    Pro

ggtcattatcacatggacttttcgtaa ccagtaatagtgtacct be # 42, 45% GC