Van Oudenaarden Lab:F38C2.8

From OpenWetWare
Jump to: navigation, search

Progress:

Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>F38C2.8 (spliced + UTR - 495) ATGAACAACT ACAAAATGAG AATTGAAGAT CAAAAAGTAC AAATAACTGA AATTCTTCAA ATCTTTATGT CTGCCCGCGA AAATGATTCT GGAAAATGGA AAGATTGCGG ATTAGATATG ATACGCAACA AGATAAATGA GAAATATATG GCCCAATCAG GGCTTGGATC TCAAGTTAAA TTGTCCGGTT TATTGAGTAA GGACGGCAAG CTGTCGAGTC GGAAAATGAA ATCGTCAAAG CTCTTGAAAA GATGCCGAAT GCATGACTTA AACGAGGCAC TTGACGATCT GCGAGCTGTA ATTCCATATG CTCACGGGGG TTCCGTGAGG AAGTTGAGCA AGATTGCTAC GTTGCTTTTG GCTAAAAATC ATATCATCAT GAAGGCAAAA GCGATTGAGG AGCTCAGTGT ATTGGTCTCC CAGTTGAAGC AGAAATCGGA AAATTCTAAG AACTTGAACA AATCCGTGAA GCCATCAAGC GACCATGTAG ACTAA


Name of probe set: hlh-31 Probes designed on Wed, 03 Mar 10 23:26:43 -0700 20 probes designed for target of length 495

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

ctcattttgtagttgttcat, hlh-31_1, 1, 1, 30 cagacataaagatttgaaga, hlh-31_2, 2, 54, 30 tttccagaatcattttcgcg, hlh-31_3, 3, 76, 40 atctaatccgcaatctttcc, hlh-31_4, 4, 98, 40 catttatcttgttgcgtatc, hlh-31_5, 5, 120, 35 ccctgattgggccatatatt, hlh-31_6, 6, 143, 45 ccggacaatttaacttgaga, hlh-31_7, 7, 169, 40 cttgccgtccttactcaata, hlh-31_8, 8, 191, 45 cgatttcattttccgactcg, hlh-31_9, 9, 215, 45 ggcatcttttcaagagcttt, hlh-31_10, 10, 237, 40 gcctcgtttaagtcatgcat, hlh-31_11, 11, 259, 45 tacagctcgcagatcgtcaa, hlh-31_12, 12, 281, 50 aacccccgtgagcatatgga, hlh-31_13, 13, 303, 55 atcttgctcaacttcctcac, hlh-31_14, 14, 325, 45 tttagccaaaagcaacgtag, hlh-31_15, 15, 347, 40 gcttttgccttcatgatgat, hlh-31_16, 16, 373, 40 caatacactgagctcctcaa, hlh-31_17, 17, 395, 45 atttctgcttcaactgggag, hlh-31_18, 18, 417, 45 cacggatttgttcaagttct, hlh-31_19, 19, 449, 40 tctacatggtcgcttgatgg, hlh-31_20, 20, 472, 50


Input sequence with probe locations:


atgaacaactacaaaatgagaattgaagatcaaaaagtacaaataactgaaattcttcaaatctttatgt tacttgttgatgttttactc agaagtttagaaataca Probe # 1, 30% GC Probe # 2, 30% GC

ctgcccgcgaaaatgattctggaaaatggaaagattgcggattagatatgatacgcaacaagataaatga gac gcgcttttactaagaccttt cctttctaacgcctaatcta ctatgcgttgttctatttac

    Probe # 3, 40% GC     Probe # 4, 40% GC     Probe # 5, 35% GC    

gaaatatatggcccaatcagggcttggatctcaagttaaattgtccggtttattgagtaaggacggcaag

 ttatataccgggttagtccc      agagttcaatttaacaggcc  ataactcattcctgccgttc
 Probe # 6, 45% GC         Probe # 7, 40% GC     Probe # 8, 45% GC   

ctgtcgagtcggaaaatgaaatcgtcaaagctcttgaaaagatgccgaatgcatgacttaaacgaggcac

   gctcagccttttactttagc  tttcgagaacttttctacgg  tacgtactgaatttgctccg  
   Probe # 9, 45% GC     Probe # 10, 40% GC    Probe # 11, 45% GC    

ttgacgatctgcgagctgtaattccatatgctcacgggggttccgtgaggaagttgagcaagattgctac aactgctagacgctcgacat aggtatacgagtgcccccaa cactccttcaactcgttcta gatg Probe # 12, 50% GC Probe # 13, 55% GC Probe # 14, 45% GC Prob

gttgcttttggctaaaaatcatatcatcatgaaggcaaaagcgattgaggagctcagtgtattggtctcc caacgaaaaccgattt tagtagtacttccgttttcg aactcctcgagtcacataac gagg e # 15, 40% GC Probe # 16, 40% GC Probe # 17, 45% GC Prob

cagttgaagcagaaatcggaaaattctaagaacttgaacaaatccgtgaagccatcaagcgaccatgtag gtcaacttcgtcttta tcttgaacttgtttaggcac ggtagttcgctggtacatc e # 18, 45% GC Probe # 19, 40% GC Probe # 20, 50% GC

actaa t