Van Oudenaarden Lab:F27E5.2

From OpenWetWare
Jump to: navigation, search

Progress:

Probes designed: (3-04-2010 - Ni Ji)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


>F27E5.2 (spliced + UTR - 927) *PARTIALLY confirmed cDNA sequence

ATGACCACAG ATTCTATCAC ATTTAATCAC ATTCTTGGGC AGGGTCGTGT TAACCAACTC GGTGGAGTTT TCATCAACGG TCGACCCCTT CCAATTCACG TTCGTCATGC TATCATTTCA ATGGCCAAAA AGGGTATAAA ACCATGTCAC ATCAGTCGTC AACTCAAAGT ATCTCATGGA GCTGTTTCGA AAATCTTGAA TCGTTACGCC GAGACGGGCT CAATATCTCC GGGACAGATC GGTGGAAGTC CCCGCGCTCG ACTTACAGTC CAAGCCGTCG AGAAAGAAAT TCTGATCGCA TGTGATGAGA ATCCACAAAT GAGCGCTGCA GAGCTCCGAG ATTGGCTTAT TCACAAAGAC ATTTGCACAA AAGGAAATGC TCCAACAGTA CCTGCGATAA AAAGGCTTAT TGGGAATAAA GGCGTCGGGG TTCCGAAGAA AATGGAACGA AAACGGCTGA GCTACAGTAT CGACAGCATT CTGGGAATTT CAATTGACGA ATGCAGCAAA TCGTCATCGG ATGACGAAGA GGGCTCTTCA CCATCAAACG ACGCATCGTC TCGTCGAAAT CGTACATCAT TCACTGCCGA GCAACTAGAT GTTCTTGAAA ATGCGTTCCG CGCAGACACT TACCCACATG CCAACGCCAG AGAGAGCATT TCCAAGGAGA CAGGGCTCAG CGAAGAGAAA ATTATGACGT GGTTTTCGAA TCGGCGAGCA AGATGTCGGA AAAATATGCC AATGTATCAA CAGTACAATG TTCAAGGTTT TGGATCATCT CCGCCGTCCT ACCCAACGCT GCTGCCTTCA CCGATGATGT TCCTACCCTC CTACTCAACG AGTCCTCAAT TGAATCCGTT ATTCTTTCAA CACATACTCC AATCAAGTCC CCCATCAAGT CAATCATCTC CGCCATCATC AAGCTAA


Name of probe set: pax-3 Probes designed on Thu, 04 Mar 10 14:02:41 -0700 42 probes designed for target of length 927 (target too short for 48 probes)

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

gtgatagaatctgtggtcat, pax-3_1, 1, 1, 40 ctgcccaagaatgtgattaa, pax-3_2, 2, 23, 40 caccgagttggttaacacga, pax-3_3, 3, 45, 50 ggtcgaccgttgatgaaaac, pax-3_4, 4, 67, 50 atgacgaacgtgaattggaa, pax-3_5, 5, 89, 40 ttttggccattgaaatgata, pax-3_6, 6, 111, 30 atgtgacatggttttatacc, pax-3_7, 7, 133, 35 agatactttgagttgacgac, pax-3_8, 8, 155, 40 agattttcgaaacagctcca, pax-3_9, 9, 177, 40 cccgtctcggcgtaacgatt, pax-3_10, 10, 199, 60 gatctgtcccggagatattg, pax-3_11, 11, 221, 50 gtcgagcgcggggacttcca, pax-3_12, 12, 243, 70 ttctcgacggcttggactgt, pax-3_13, 13, 265, 55 atcacatgcgatcagaattt, pax-3_14, 14, 287, 35 cagcgctcatttgtggattc, pax-3_15, 15, 309, 50 ataagccaatctcggagctc, pax-3_16, 16, 331, 50 ttttgtgcaaatgtctttgt, pax-3_17, 17, 353, 30 caggtactgttggagcattt, pax-3_18, 18, 375, 45 ttcccaataagcctttttat, pax-3_19, 19, 397, 30 cttcggaaccccgacgcctt, pax-3_20, 20, 419, 65 tcagccgttttcgttccatt, pax-3_21, 21, 441, 45 agaatgctgtcgatactgta, pax-3_22, 22, 463, 40 gcattcgtcaattgaaattc, pax-3_23, 23, 485, 35 cgtcatccgatgacgatttg, pax-3_24, 24, 507, 50 tttgatggtgaagagccctc, pax-3_25, 25, 529, 50 atttcgacgagacgatgcgt, pax-3_26, 26, 551, 50 gctcggcagtgaatgatgta, pax-3_27, 27, 573, 50 gcattttcaagaacatctag, pax-3_28, 28, 595, 35 tgggtaagtgtctgcgcgga, pax-3_29, 29, 617, 60 tgctctctctggcgttggca, pax-3_30, 30, 639, 60 ctgagccctgtctccttgga, pax-3_31, 31, 661, 60 ccacgtcataattttctctt, pax-3_32, 32, 683, 35 atcttgctcgccgattcgaa, pax-3_33, 33, 705, 50 tacattggcatatttttccg, pax-3_34, 34, 727, 35 accttgaacattgtactgtt, pax-3_35, 35, 749, 35 aggacggcggagatgatcca, pax-3_36, 36, 771, 60 tcggtgaaggcagcagcgtt, pax-3_37, 37, 795, 60 gagtaggagggtaggaacat, pax-3_38, 38, 817, 50 cggattcaattgaggactcg, pax-3_39, 39, 839, 50 ggagtatgtgttgaaagaat, pax-3_40, 40, 861, 35 tgacttgatgggggacttga, pax-3_41, 41, 883, 50 gcttgatgatggcggagatg, pax-3_42, 42, 905, 55