Van Oudenaarden Lab:C17C3.8

From OpenWetWare
Jump to: navigation, search


Probes designed: (03-04-2010 - Christoph Engert)

Probes coupled:

Probes purified:

Probes tested:

Dyes available:


Name of probe set: hlh-26 Probes designed on Wed, 03 Mar 10 23:47:03 -0700 30 probes designed for target of length 755

Probe (5'->3'), Probe name, Probe number, Probe position, Percent GC

gaagttggagaggaagacat, hlh-26_1, 1, 1, 45 aagaaggggacccagatgat, hlh-26_2, 2, 24, 50 gtttcagatcgatgtccatg, hlh-26_3, 3, 46, 45 cagatcattagtatcatctc, hlh-26_4, 4, 80, 35 cgattttcttgaattcattc, hlh-26_5, 5, 102, 30 gaaagtttttcagattccga, hlh-26_6, 6, 130, 35 acgaaatagaacctcttctt, hlh-26_7, 7, 152, 35 gaagttgaataccagataac, hlh-26_8, 8, 183, 35 gatgttgaaaacgattcgtg, hlh-26_9, 9, 205, 40 aatacttctaattggtccag, hlh-26_10, 10, 227, 35 gttcccgatcgcttttaatc, hlh-26_11, 11, 252, 45 actctcttatttcggcgaac, hlh-26_12, 12, 274, 45 ttttctgagctctctgtacg, hlh-26_13, 13, 299, 45 ctgagctactcaaattattc, hlh-26_14, 14, 330, 35 ttctccattttgtctatttc, hlh-26_15, 15, 352, 30 gatgatttctagaaccttca, hlh-26_16, 16, 374, 35 gactttccacgaatcacttc, hlh-26_17, 17, 397, 45 gcaaggtactgtacatgtga, hlh-26_18, 18, 419, 45 aaggaagtattggaaatggt, hlh-26_19, 19, 441, 35 taaactgggaatactgggag, hlh-26_20, 20, 463, 45 tgaattgaaaactaatggcg, hlh-26_21, 21, 485, 35 gtgaggaggataaagtgaaa, hlh-26_22, 22, 515, 40 taggaatctgaactgtaggc, hlh-26_23, 23, 537, 45 ttcgaagctggaacttggga, hlh-26_24, 24, 560, 50 cttctatttccagagcgtca, hlh-26_25, 25, 582, 45 cagccaacaatatcgatatc, hlh-26_26, 26, 613, 40 acgattttcagctgaatctc, hlh-26_27, 27, 635, 40 gttgaaaaaaattggagacc, hlh-26_28, 28, 658, 35 gatgtctaaataatgttgaa, hlh-26_29, 29, 682, 25 ttcaatgaatcgggatgcaa, hlh-26_30, 30, 704, 40

Input sequence with probe locations:

atgtcttcctctccaacttcgtcatcatctgggtccccttcttcacatggacatcgatctgaaacagaaa tacagaaggagaggttgaag tagtagacccaggggaagaa gtacctgtagctagactttg Probe # 1, 45% GC Probe # 2, 50% GC Probe # 3, 45% GC


        ctctactatgattactagac  cttacttaagttcttttagc        agccttagact
        Probe # 4, 35% GC     Probe # 5, 30% GC           Probe # 6, 

aaaactttcaaaagaagaggttctatttcgtattgtgaaattgttatctggtattcaacttcatcacgaa ttttgaaag ttcttctccaagataaagca caatagaccataagttgaag gtgctt 35% GC Probe # 7, 35% GC Probe # 8, 35% GC Probe

tcgttttcaacatcgcctggaccaattagaagtattaaaaagattaaaagcgatcgggaacaagttcgcc agcaaaagttgtag gacctggttaatcttcataa ctaattttcgctagcccttg caagcgg

  1. 9, 40% GC Probe # 10, 35% GC Probe # 11, 45% GC Probe #

gaaataagagagttgccgcgtacagagagctcagaaaatttattgcattgaataatttgagtagctcaga ctttattctctca gcatgtctctcgagtctttt cttattaaactcatcgagtc

12, 45% GC       Probe # 13, 45% GC             Probe # 14, 35% GC   


ctttatctgttttacctctt  acttccaagatctttagtag   cttcactaagcacctttcag  ag
Probe # 15, 30% GC    Probe # 16, 35% GC     Probe # 17, 45% GC    Pr

acatgtacagtaccttgcctaccatttccaatacttccttttctcccagtattcccagtttattcgccat tgtacatgtcatggaacg tggtaaaggttatgaaggaa gagggtcataagggtcaaat gcggta obe # 18, 45% GC Probe # 19, 35% GC Probe # 20, 45% GC Probe

tagttttcaattcatacaatcaattttcactttatcctcctcacatgcctacagttcagattcctattgt atcaaaagttaagt aaagtgaaataggaggagtg cggatgtcaagtctaaggat a

  1. 21, 35% GC Probe # 22, 40% GC Probe # 23, 45% GC P

cccaagttccagcttcgaaattgacgctctggaaatagaagaaaatgagaaagatatcgatattgttggc gggttcaaggtcgaagctt actgcgagacctttatcttc ctatagctataacaaccg robe # 24, 50% GC Probe # 25, 45% GC Probe # 26, 40% GC

tgaagagattcagctgaaaatcgtattggtctccaatttttttcaacagttttcaacattatttagacat ac ctctaagtcgacttttagca ccagaggttaaaaaaagttg aagttgtaataaatctgta

   Probe # 27, 40% GC     Probe # 28, 35% GC      Probe # 29, 25% GC 

cttttgcatcccgattcattgaaaattaataaatttaaaaaagtaacatcaagat g aacgtagggctaagtaactt

  Probe # 30, 40% GC