User:Ulyana Simakova/Notebook/Alien species Anadara kagoshimensis/2014/09/01

From OpenWetWare
Jump to: navigation, search
Anadara kagoshimensys.png Alien species Anadara kagoshimensis <html><img src="/images/9/94/Report.png" border="0" /></html> Main page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>

Analyse existing data to create REALY specific primers

Using my data and data from Tanaka, Aranishi(2013, Genbank id's: AB854359.1-AB854417.1) and de Carlos, Banon(unpub, Genbank id's: KF417435.1-KF417440.1) Tanaka used his own primer as forward and HCO2198 as reverse. He accuired contig of 555 bp length of which first 8 bps are from primer (HCO2198)

Results

  1. I found some difference between HCO2198 and real sequence in my specimen here they are:
  • TAAACTTCAGGGTGACCAAAAAATCA - HCO2198 (53°C)
  • TAGACTTCTGGATGACCAAAAAACCA - Sequence from Black sea Anadara (54°C)

4 differenences between. I Have to order new primer to try. Temperature differences between f&r are big but i dont see any difference with HCO2198 Also new primer can create a self dimers and hairpins but not really big.

What Next

  1. order new primer to try AnHCO2198 - TAGACTTCTGGATGACCAAAAAACCA

And try to Use it