User:Tk/Notebook/MF/2008/07/31

From OpenWetWare
< User:Tk‎ | Notebook‎ | MF‎ | 2008‎ | 07
Jump to: navigation, search
Owwnotebook icon.png Mesoplasma florum simplification <html><img src="/images/9/94/Report.png" border="0" /></html> Main Page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;</html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Transposon insertion event at 523000-525000

A pseudogene and inactive IS3/IS1138 transposon is at 523336-524543

  • IRL: 523336-523356
  • IRR: 524523-524543
  • The sequence of the transposon insertion site is: ataaactgggaaaaataaaat / ataaactgggaaaaaataaat
  • Compare to the IS1138 transposon end sequences: taaactgggacaaaaaaat / taaactaggacaaaaaaact


  • Transposase gene has three frame shifts and multiple stop codons (both TAA and TAG)
  • Approximate locations:
    • 523660-524485
    • Frame 1: 523660-523993
    • Frame 3: 523969-524161
    • Frame 2: 524170-524260
    • Frame 3: 524275-524485


  • There may be a six bp repeat outside of the IRL/IRR boundary:
    • taagca on the left
    • gatgca on the right


  • Tn5 transposon insertion events captured:
    • TT01-3111_TT01-.seq 524040 fwd
    • TT01-3233_TT01-.seq 524201 rev
    • TT01-2677_TT01-.seq 524358 fwd
    • TT01-3383_TT01-.seq 524358 fwd