User:Tanguy Chau/Notebook/Research/2008/07/10

From OpenWetWare
< User:Tanguy Chau‎ | Notebook‎ | Research‎ | 2008‎ | 07
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page

Ligation of R797, R796 into T7 415-1b Vector

Inserts obtained from Tim Lu R797: EcorI-Cecropin-HindIII @ 27.9ng/ul

Apporoximate size/sequence: GAATTC|STOP|AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG|ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCC|SWLSKTAKKLENSAKKRISEGIAIAIQGGPR|GGATCCGGCTGCTAACAAAGCCCGAAGCTT

  • ~242bp , with ~660g/mol.bp  ~160,000 g/mol
  • For 0.06pmol of insert, need 9.6 ng of insert
  • Need 0.344 ul of R797 insert

R796: EcoRI-Indolicidin-HindIII @ 15.1ng/ul

  • Apporoximate size/sequence:

GAATTC|STOP|AGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATG|ATGAAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCC|ATTCTGCCGTGGAAATGGCCGTGGTGGCCGTGGCGCCGCTGA|GGATCCGGCTGCTAACAAAGCCCGAAGCTT

  • ~253bp , with ~660g/mol.bp  ~160,000 g/mol
  • For 0.06pmol of insert, need 9.6 ng of insert
  • Need 0.635 ul of R797 insert

Ligation Reaction

  • 5 μl Total volume:
  • 1 ul insert (0.02–0.06 pmol) or Positive Control Insert or no insert negative control
  • 1 ul T7Select Vector Arms (0.5 μg; 0.02 pmol)
  • 1.5 ul 10X T4 DNA Ligase Reaction Buffer
    • 10mM ATP
    • 100mMDTT
  • 0.5 ul Sterile water
  • Hold at 55C for 10 min
  • 1 μl T4 DNA Ligase (0.4–0.6 Weiss units)
  • Ligate at 16C for 3-16h