User:Sean P Corum/Notebook/PHIX174 Cell Free/2012/07/24

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png PHIX174 Cell Free Expression Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Hypothesis 2: Gene L is necessary for phage propagation.

  • From yesterday's whole plasmid PCR of ΦX174...
    • Quantifluore result:
      1. GATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAAC (45-mer, Tm = 63 °C, annealing T = 58 °C) = 1020nM or ~1.0×105X amplification from 0.1nM template
      2. GGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGATACTTGGAACAATTTCTGG (63-mer, Tm = 69 °C, annealing T = 64 °C) = 1447nM or ~1.5×105X amplification
      4. pWhitescript positive control, CCATGATTACGCCAAGCGCGCAATTAACCCTCAC (34-mer, Tm = 64 °C, annealing T = 69 °C) = 936nM or ~1.3×105X amplification
    • ANALYSIS: the level of amplification correlates to the N-mer length with R2=0.706, whereas it corresponds to the melting temperature with R2=0.298 and the annealing temperature with R2=0.554. The length corresponds to the annealing temperature with R2=0.560 and to the melting temperature with R2=0.244. When the pWhitescript positive control data point is excluded, these R2 values change to 0.921, 0.230, 0.743, 0.940, and 0.500, respectively.
    • DISCUSSION: Longer N-mers, which have corresponding higher annealing temperatures, give better amplification during whole plasmid PCR. Therefore, N-mer length and annealing temperature, which correlate with each other, are key factors that should be increased when choosing primers for whole plasmid PCR. Melting temperature is not important, as long as it is above the 55 °C annealing step during the PCR reaction. N-mer length should also probably not be too large, since self-annealing or other structure formation may reduce PCR efficiency at some point. For practical reasons, N-mer length should probably be ~≤ 100b ideally.
    • CONCLUSION: For this whole plasmid PCR, I will use the 77-mer primers (labeled ΦX174 3 S and ΦX174 3 AS).
      • Optimize primer concentration using a range of 100, 200, 1000, and 2000 nM primers.
      • Use PFU ligase during the PCR reaction to repair the nicked DNA.
      • Mutagentic whole plasmid PCR to create the ΦX174 L21STOP mutant.
    • Gel electrophoresis result (same labels as above)
      1. Fairly specific band at ~3kb dsDNA, consistent with specifically amplified 4.5kb nicked DNA.
      2. Unspecific amplification at >5kb dsDNA, inconsistent with specifically amplified 5.4kb nicked DNA.
      3. Unspecific amplification at >5kb dsDNA (same as 2), inconsistent with specifically amplified 5.4kb nicked DNA.
      4. Extremely unspecific amplification. Size indeterminable.
      • CONCLUSION: Longer N-mer primers with higher annealing temperatures lead to higher but more unspecific amplification. It looks as if the size of the N-mer needs to be optimized with specificity, and something like a 34-mer may be the best choice. However, I note in this experiment, I used cloned PFU DNAP, not high fidelity PFU DNAP. I will need to repeat this experiment with HF PFU DNAP. In the meantime, I can still optimize primer concentration using the 45-mer.
  • Performed whole plasmid PCR with ΦX174 primer 1 (45-mer) with range of primers: 0, 100, 200, 500, 1000 nM.
  • Ordered 5'-phosphorylated 33-mer primers:
    • Annealing temperature = 58 °C
    • Tm = 63 °C

Hypothesis 3: Gene L codes for a ~6 kDA protein.

  • Performed hybridization to create NcoI-COIL1-XhoI and NcoI-COIL2-XhoI linkers.
  • Performed double digestion of 67nM pBEST-OR2OR1Pr-UTR1-deGFP-T500 with NcoI and XhoI (30μL total volume).