User:Saroj Pandey/Notebook/SNP PCR optimization/2014/11/14

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      

Final separation and gradient PCR

PTC taster and non-taster separation

Two primer pairs were taken so that the PTC taster and non-taster could be separated.

Separation PCR
electrophoresis


Taster specific primer pair:

EP9_F: AGCTATGCCCCCTTTCCTCT

Cfb(R): CAATCACTGTTGCTCAGTGG

Product size: 911bp


Non-taster specific primer pair:

ga_F: ATCCGTGATGCTGTGCTATG

Gfb(R): CAATCACTGTTGCTCAGTGC

Product size: 510bp


Observation

• Taster: Taster specific primer pair produced a 911bp band while there were no specific bands with non-taster specific primer pair.

• Non-taster: Non-taster specific primer pair produced a 510bp band while there were no specific bands with taster specific primer pair.

• Blanks: Water sample used instead of the genomic DNA produced only unspecific products, primer dimers probably, with both sets of primers.


Conclusion

• PTC taster and non-taster can be identified genotypically with PCR using the primer pairs used in this experiment.



Gradient PCR

Gradient PCR using the specific primer pairs was performed to identify optimal temperature for both taster and non-taster.

gradient PCR
electrophoresis


Observation

• All the temperatures applied in this PCR were able to produce specific bands for both taster and non-taster.

• There were also a few unspecific bands with taster DNA at lower temperatures.

• The most prominent bands for both the taster and the non-taster DNA samples were observed at 58.2°C and 61.5°C.


Conclusion

• Optimal temperature for a PCR to separate the taster and non-taster alleles lies between 58.2°C and 61.5°C.