User:Saroj Pandey/Notebook/SNP PCR optimization/2014/11/13

Project name

Main project page Previous entry      Next entry

Allele Specific PCR Four different forward primers were used in combination with the two specific reverse primers for taster and non-taster. saliva PCR electrophoresis Forward primers used: EP9_F: AGCTATGCCCCCTTTCCTCT EP7_F: TGGAAAGGAACCATGCATTT GaF  : ATCCGTGATGCTGTGCTATG EP3_F: CCCTCTAAGTTTCCTGCCAGA Reverse primers used: Cfb(R): CAATCACTGTTGCTCAGTGG Gfb(R): CAATCACTGTTGCTCAGTGC Expected product sizes: 911bp, 760bp, 510bp, 356bp Observation • For taster, first three combinations of the primers gave bands at specific positions but the EP_3+Cfb(R) did not give specific band. This is because the enzyme was not added to the mixture during the PCR. So the amount of unspecific product is much higher. • All the primer combinations worked and showed specific bands at correct positions for non-taster. • Unspecific primers did not produce bands as with the specific ones. So the separation was successful. Conclusion • With these primer combinations, the taster and non-taster of the phenylthiocarbamide (PTC) can be identified genotypically.