User:Raf Aerts/Notebook/Open Coffee/2009/02/26

From OpenWetWare
< User:Raf Aerts‎ | Notebook‎ | Open Coffee‎ | 2009‎ | 02
Jump to: navigation, search
Owwnotebook icon coffee.pngOpen Coffee Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Coffea arabica :: selected primer sets

Reference Link Locus EMBL Repeat motif F primer R primer
Combes et al 2000 Molec Ecol DOI M3 AJ250251 (CA)6/(CA)3/(CA)3/(CA)3/(CA)4/(CA)3/(CA)3/(CA)3 ATTCTCTCCCCCTCTCTGC TGTGTGCGCGTTTTCTTG
Combes et al 2000 Molec Ecol DOI M20 AJ250253 (GA)5/(GT)8/TT(GT)4/TT(GT)7(GA)11(TC)2(CT)3GT CTTGTTTGAGTCTGTCGCTG TTTCCCTCCCAATGTCTGTA
Combes et al 2000 Molec Ecol DOI M24 AJ250254 (CA)15(CG)4CA GGCTCGAGATATCTGTTTAG TTTAATGGGCATAGGGTCC
Combes et al 2000 Molec Ecol DOI M25 AJ250255 (GT)5/CT(GT)2/(GT)12 CCCTCCCTGCCAGAAGAAGC AACCACCGTCCTTTTCCTCG
Combes et al 2000 Molec Ecol DOI M27 AJ250256 (GT)11 AGGAGGGAGGTGTGGGTGAAG AGGGGAGTGGATAAGAAGG
Poncet et al 2004 Genome DOI M742 AJ308742   GGCTTCTTGGGTGTCTGTGT CCATTGGCTTTGTATTTCTGG
Poncet et al 2004 Genome DOI M753 AJ308753 (CA)15 GGAGACGCAGGTGGTAGAAG TCGAGAAGTCTTGGGGTGTT
Poncet et al 2004 Genome DOI M782 AJ308782 (GT)15 AAAGGAAAATTGTTGGCTCTGA TCCACATACATTTCCCAGCA
Poncet et al 2004 Genome DOI M793 AJ308793   CTGAGCGCATGGAAGGAGTA GGAGACGCAGGTGGTAGAAG
Poncet et al 2004 Genome DOI M802 AJ308802   AATGAAGAAGAGGGTGGTG CGAGGGTATTGTTTTCCAG
Poncet et al 2004 Genome DOI M822 AJ308822   TGCGAAGAGAAAAGTAACCAA TCACTGCAAGCTGTTAAATGAT
Silvestrini et al 2007 Gen Res Crop Evol DOI SSR7 AJ308762 (TG)16 CTGGGTTGGTTCTGATTTTG GGTTCCCAGAGATTCTCTCC
Silvestrini et al 2007 Gen Res Crop Evol DOI SSR17 AJ308754 (CA)12 AAGGGGAGTGGATAAGAAGG GGCTGGATTTGTGCTTTAAG
Cubry et al 2008 Genome DOI 350 AM231550 (GT)8 TCAAAAGAGGGCACGAA ACGACAATAACTTTGCATGTCT
Hendre et al 2008 BMC Plant Biol DOI CaM03 EU526558 (AC)11 CGCGCTTGCTCCCTCTGTCTCT TGGGGGAGGGGCGGTGTT
Hendre et al 2008 BMC Plant Biol DOI CaM18 EU526567 (TC)9 CCGACTTGGACTGATGCGAAATTGA AAAGCAAAAAACCAGAAAACACGAAGA
Hendre et al 2008 BMC Plant Biol DOI CaM22 EU526570 (AT)15 CCCCTCCTCCTCCTACTAGATGGTGGT GGTCCAGGGTCCATCCATTCTTGA
Hendre et al 2008 BMC Plant Biol DOI CaM25 EU526573 (GA)9 TCCATCTTCCTTCATTTCTGCTGCTAA CCTTCACCCCCTTTGCACTTCCTTA
Hendre et al 2008 BMC Plant Biol DOI CaM42 EU526586 (CT)8 TGGGTCAAGGATCCGTGTAAGAAAGA CCCTCACCAGTTCCCGATGTCAG
Hendre et al 2008 BMC Plant Biol DOI CaM44 EU526588 (CT)9 TGCTCTTGCCCTCTTTCATCC TCCCGAAAAAGAAAATAAGATAAAGAG