User:Pedro Matos/Notebook/Aulas Biologia Molecular 2010/2010/04/20

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

TP5-PCR e RT-PCR (continuação)

Questões

  • Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.

Partindo de uma amostra de esfregaco da mucosa bucal de cada um dos familiares processamo-la, isto e, usamos acido para destruir as membranas celulares e depos neutralizamos a solucao ficando com DNA em solucao.

A essa solucao adicionamos:

os primers forward TCTGGAGACGCAGGAAGAGATCC e o reverse GCAGAATCCAGATGCTCAAGGCCC
DNA polimerase,
Deoxinucleotidos,
Tampão,
Água
Cloreto de Magnesio.

Depois com o produto de PCR fazemos a sequenciacao usando os primers: CATATTCTGGAGACGCAGGA (5’ → 3’) TGTACACATATTGACCAAATCAGG (5’ → 3’) ATGGGACGCTTGATGTTTTC (5’ → 3’) GGCATAAAAGTCAGGGCAGA (5’ → 3’)

Compararia os resultados das 3 amostras.

  • Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.

Partindo de uma amostra de esfregaco da mucosa bucal de cada um dos familiares processamo-la, isto e, usamos acido para destruir as membranas celulares e depos neutralizamos a solucao ficando com RNA em solucao.

A essa solucao adicionamos:

o primers CTTTCTTGCCATGAGCCTTC
Transcriptase reversa,
Deoxinucleotidos,
Água,
Tampão
Cloreto de Magnésio.

Desta reacção obteríamos cDNA que depois usaríamos numa reacção de PCR com:

Primers RIGHT primer: CTTTCTTGCCATGAGCCTTC LEFT primer: TCTGTCCACTCCTGATGCTG
DNA polimerase,
Deoxinucleotidos,
Tampão,
Água
Cloreto de Magnesio.

Depois com o produto de PCR fazemos a sequenciacao e comparamos os resultados