User:Paola Quinones Lopez/Notebook/Lab 5: Invertebrates & Vertebrates CORRECTED

From OpenWetWare
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:Paola Quinones Lopez/Notebook/Lab 5: Invertebrates & Vertebrates CORRECTED</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages Help.png

Lab 5: Invertebrates & Vertebrates

I. Purpose

The purpose of this experiment is to learn the importance of vertebrates and to see how simple systems evolved into more complex systems. Another objective is to learn how to use a dichotomous key to identify invertebrates, define deuterostome & protostome, and to recognize whether an animal has radial or no symmetry.

II. Methods and Materials

First, we observed the acoelomate, Planaria with the dissecting scope and observed its movement and cross section. We then observed the nematodes and their cross sectional slide of their pseudocoelomate structure. Then, we observed the coelomate Annelida and looked at the position of the internal organs. Afterwards, we observed the example organisms from each of the five major classes and classified each of the organisms. We then analyzed the invertebrates collected with the Berlese funnel by breaking down the funnel, pouring the top 10-15ml of 50% ethanol and organisms into a petri dish and pouring the remaining liquid into a second dish. Then, we examined both dishes using a dissecting microscope. We identified the class of any invertebrate we observed and annotated them in the graph.

III. Graphs & Pictures

Lab5-1.jpg Lab5-2.jpg Lab5-3.jpg Lab5-4.png


IV. Conclusion

We had limited species because our funnel was small, therefore our sample size was small as well and there were less organisms that could be collected. Also, our transect was very limited in terms of ecosystems, so there was little variation of ecosystems and there will not be many distinct species living in our transect and that could be the reason why we found 6 springtales and only 1 flea.

March 3, 2016

Assignment:

Sequencing Transect 3:

Sample D: MB66 NNNNNNNNNNNNNNNNNANANTGNANNCCNNAGCGGTAGCAGANGNTATCANGATGTCCGACAGCGGCTTGCNGATGAGG TACAAGTGTGGTTTATGCCTTTAGCCGGGGGAGGCACTTTCGTTGGGAAGATTACAACCCCATAATTATAATCGTGGCAT CTCTTGAAANGGACTGGTCCAGTGGAAAAAGAAGGGCCCGACCCTGATGANGCAGTTGGTACGGGGACGGTTCACCANGG CTGTGATGTTTGTGGGGCCTGANAGGGTGATCCCCCTGTGTGGTACGGAGACATTGACCCAACACCAATTGCAGGCGCCT CTGAGGAATATTGGACAATGGGTGAGAGCCTGATCNNNANTCNNCGNGAAGGATGACGGTGCTCCTGGTTGTATTCTTCT TTTGTATATTGATGGTGATTTCCTCGTGGGTGAAGCTGAATGAACTATACAAGCAGNAACCGGNGAGGCCCNTGCCTTCA GCCTCGGTNNTACNCAGGGTGTTGCCGTTTGAGAGATTTATTGNNTTNTCGAGGTTGGTTCNNGCNGANGGCNNACAATA TGCTGTANNNNTNACTNNNNGGTCAATCTGCATANGTTGGCGCGNGNCGCGACTNTTGGATATCTACCTTGCNTAAAANA NTCNNACANGGAANNCNTANATAATANCNNNNNCACCAATTGCGAANGCAGGTTACTATGTCTTAACTGACGCTGATGGA CGAAAGCGTGGGGAGCGAACAGGATTANATACCCTGGTANTCCACGCCNTNNNNNATGCTNACTCGTTTTTGGGNTCTTC NGATTCAGAGACTAAACNAAAGTGATAAGTTAGCCACCTGGGGAGTACGTTCNCAAGANTGAAACTCNAAGGAATTGACN GNNCCCGCACAANCGGNGGATTATGTGNNTTNATTCNATGATACGCNANGAANCCTTNNCCNANGCTTAANTGGGNANTN GATCGGTTTNNNANNNNACCTTNCCTTNNNCAATTTCAAGGTNCTGCATGGNTNGTCNNCNGCTNNNNCCNNNANTNNNA GNTAANTCCTGNNNNNNNGNNNCCCCNTGTCNCNNN

We did not have the PCR done because of technical issues. We had to look for the sequencing from a previous Spring 2015 lab section in order to do this. For this particular sequence, we found that the bacteria from the transect is Chryseobacterium.