User:Omar Choudary/Notebook/Omar Choudary CHEM-571 AU-2011/2012/2011/10/12

From OpenWetWare
Jump to: navigation, search
BDLlogo notext lr.png Chem-571 Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png


Objective

  • Test the conductivity of gold nanoparticle(AuNP) protein fibers using a four point probe.
  • Analysis of DNA sequence to determine if Green Fluorescent Protein(GFP) mutation was successful.

Description

  • There were two attempts to build a four point probe. The first attempt on 10/11 had failed because the probes did not stick to the teflon sheet. The second attempt was on 10/12.
  • October 11, 2011

Teflon square was cut out from large teflon sheet

Four 0.5 inch palladium wires were cut

The four wires were glued to the teflon sheet using epoxy.

Four small sheets of palladium foil were cut and glued on top of the wires using epoxy.

Area of palladium sheets:

1 - 30.24 mm^2

2 - 17.02 mm^2

3 - 16.28 mm^2

4 - 22.5 mm^2

  • October 12, 2011 (Attempt 2)

Palladium wires and foil sheets from previous experiment were glued to each other first using epoxy.

Heat gun was used to accelerate drying of epoxy.

The probe was then glued onto the teflon sheet using epoxy.

Data

  • Conductivity of AuNP's
  • After creating the four point probe, the AUNP fibers from a previous AUNP synthesis experiment were pipetted onto the four point probe. Unfortunately, not enough of the AUNP fibers were coating the probe, so the conductivity could not be tested.
  • Compared two a two-point probe, four point probes allow for a more accurate determination of conductivity:
  • The two-probe method: it uses 2 probes (the manipulation is easier but the data interpretation is harder); each contact serves as a current and and as a voltage probe.
  • The four-probe method: it uses 4 probes (the manipulation is harder but the data interpretation is easier). There are:

Two outside probes (1 and 4) which induce a current through the actuator; the actuator owns its own resistance so when the current is flowing through it, there would be a voltage drop.

Two inside probes (2 and 3) which are connected to a voltmeter; it permits to measure the voltage drop. The actuator’s resistance is equal to the voltage measured using voltmeter divided by the known current applied to the actuator.

  • Conductive Epoxy is a silver glue which provides an excellent electrical conductivity and thermal conductivity. It is ideal material for measuring current.


  • DNA Sequencing
  • The DNA sequence of interest is shown below. The sequence shows that the mutation was unsuccessful because it was not changed.
  • ATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGAT
  • Target Codon (GAT) at the end of the sequence remained unchanged.

Notes