User:Nader A. Khamis/Notebook/Experimental Biological Chemistry AU Fall 2011/2011/11/01

From OpenWetWare
Jump to navigationJump to search
Project name Main project page
Previous entry      Next entry


Objective

  • Synthesis of BSA Conjugated Gold Nanoparticles using H2O as a buffer and preparation of BSA solution using HCl as a buffer. The purpose is to investigate the effects of pH on the formation of protein aggregates.
  • Perform PCR to mutate Green Fluorescent Protein (GFP) to include a cysteine residue after the enterokinase cleavage site. This is a repetition of the experiment conducted on September 20th, 2011.

Description

  1. Approximately 1ml of BSA stock solution (15.5µM), 1ml of HAuCl4 stock solution (2.9mM) were pipetted into a test tube and was filled with 8ml of H2O.
  2. Approximately 1ml of BSA stock solution (15.5µM), 1ml of HCl(3M) were pipetted into a test tube and was filled with 8ml of H2O
  3. The following steps were then carried out:
  • Leave solution in oven for 30 minutes.
  • Remove solutions from oven and keep them in room temperature for 10 minutes.
  • Place solutions back in oven.
  • Repeat cycle for 2 hours.

PCR

  1. A solution containing 5µL of 10X Pfu Buffer, 1µL of each primer, 1µL of DNA sample, 1µL of dNTP mix, 40µL of water, and 1µL of Pfu Turbo were prepared. Approximately 50µL of Wax solution was added on top of solution.
  2. The tube was placed in the thermocycler.

Cycling Program

  1. 30 sec at 95°C
  2. 30 sec at 60°C
  3. 7 min at 72°C
  4. Repeat these three steps 19 times
  5. 10 min at 72°C
  6. Leave overnight at 4°C
  • Forward primer: 5'TACGACGATGACGATAAGTGTCGATGGGGATCCGAATTC3'
  • Reverse primer: 5'GAATTCGGATCCCCATCGACACTTATCGTCATCGTCGTA3'

Data

  • The first tube containing a molar ratio of HAuCl4 to BSA of 187.1 had dark purple fibers.
  • The second tube contained no fibers and the solution was clear.

Notes

This area is for any observations or conclusions that you would like to note.


Use categories like tags. Change the "Course" category to the one corresponding to your course. The "Miscellaneous" tag can be used for particular experiments, as instructed by your professor. Please be sure to change or delete this tag as required so that the categories remain well organized. .


Retrieved from "https://openwetware.org/mediawiki/index.php?title=User:Nader_A._Khamis/Notebook/Experimental_Biological_Chemistry_AU_Fall_2011/2011/11/01&oldid=1009231"