User:Mingjie Li/Notebook/Light switch/2008/12/08

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      

ML2-1: make AAV-Flex-ss-prl-H

information

  • insert:Fck-ss-prl-H
  • backbone:AVV-Flex-chr2-td
  • restriction sites: BsrgI, KpnI

primer design for the insert

  • pML2-1_F:cgtttGGTACCgccaccatggtcccgtgcac
  • pML2-1_R:CTTATTACTTGTACAGCTCGTCCATGCCGA
gccacc:Kozak sequence