User:Meng Xiao He/Notebook/fall08/2008/11/17

From OpenWetWare
< User:Meng Xiao He‎ | Notebook‎ | fall08‎ | 2008‎ | 11
Jump to: navigation, search
Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Sequence results

  • cco flank: pER21+C1 is correct, as is TOPO A
  • Duo flank: pUC19 containing is current, but TOPO C IS NOT (contains only part of flank)
  • cbb flank: pER21+B2 is correct
  • pER21 does seem to contain the M13 forward (-21/20) priming site, along with the EcoRI site next to it. The sequence that matches w/ pUC19:
TACCGAGCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCC
TGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGT
AATAGCGAAGAGGCCCGCACCGATCGCC


All sequencing could use more scrutiny, and are not complete.

Transformations into MR-1 failed

  • For each of 3 plasmids, tried normal protocol and different one with more cells and more DNA at 1.15 KV
  • No colonies on plates
  • No growth in liquid cultures (rinsed SOC tube w/ LB and grew up in LB-Gm)