User:Mbennie/Notebook/Sequencing/8.10.2007

From OpenWetWare
Jump to: navigation, search
  • GCN4 #1 with VF2 (Template: 3ul Miniprep DNA, .3ul primer, 6.7ul water)
    • Somehow only the forward primer managed to get into the vector
NNNNNNNNNNNNNNNNNCCTATANNNATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTA
AGGATGATTTCTGGAATTCGCGGCCGCTTCTAGAGGTAAACAGCTGGAAGACAAAGTTGAAGTTTCTTCCTGCAGTCCGG
CAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCGAAAAGATTACTTCGCGTTATGCAGGCTTCCTCG
CTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCAC
AGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGC
TGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACA
GGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATA
CCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCG
TTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAG
TCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGG
TGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGC
CAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGGTTTTTTGTTTGC
AAGCAGCANATTACGCGCANAAAAAAGGATCTCAAGANNATCCTTTGATCTTTCTANGGGNCTGACGCTCANTGNNNCNA
AANTNACGTNNNGGANNTTGNCATGAGATNTCANNANGNNNTNNCCTAGANCTTTNANNNAANNNANTTNNNNNANCNNA
NNNNNNTGANTNANTNGNNNNNNGNTNNNNNNNNNNCNNNNCNATAAANNNNNNNGNNNCNNNNNNNNNNNANNNNNGNN
NNNNANNNTNNNNNNNNNNNNANGNNNNNCNNNNNGANNNNNNNNN
  • GCN4 #3 with VF2 (Template: 3ul Miniprep DNA, .3ul primer, 6.7ul water)
    • No significant similarity
NNNNNNNNNNNNTANNTATANNATAGGCGTATCACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGA
TGATTTCTGGAATTCGCGGGACTCGGCATGAACATGTTCGAACAGCAGCAGTGACGTGGTGCGCCCGCGGTCAAACACTT
CGCACCATTCGGCCTGTTTATCCTGCAGTCCGGCAAAAAAGGGCAAGGTGTCACCACCCTGCCCTTTTTCTTTAAAACCG
AAAAGATTACTTCGCGTTATGCAGGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATC
AGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGC
AAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCACAGGCTCCGCCCCCCTGACGAGCATCACAAAAAT
CGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCG
CTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCT
CACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGAC
CGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGG
TAACANGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACNGCTACNCTAGAA
GAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAA
ACCACCGCTGGTAGCGGNGGNTTTTTGTTTGCAAGCAGCNNANTACGCGCANAAAAAAANNNTNTCAAGAAGATCCTTTG
ATCTTTTCTACGGNNTCNGACGCTCNNNGNNNNAAAACTCACGTNNNNGNTTTGGNCANNNNATTATNAAAANGANNNTC
NCNAGATCTTTNNNNNAANNNANTTTNNNTNANNNANNNNNNNTNNNNAANNTNNNNNNNNNNNNGNNNNNNNNNCNNNN
AAANNNNNNNNNNNCNNNNNNNNANNNANNNNANNGNNNNNNNNNNNNNANCNGNNNNNNNNNNNNNNNNN
  • IgAbc #8 with VF2 (Template: 1ul PCR DNA, .3ul primer, 8.7ul water)
    • Part 1 and Part 3, but missing Part 2
NNNNNNNNNNNNNAATAGGCGTATACACGAGGCAGAATTTCAGATAAAAAAAATCCTTAGCTTTCGCTAAGGANGATTTC
TGGAATTCGCGGCCGCTTCTAGAGGTAGCACGCAATCTATCTTATTGGATACAGGTGCTTCATTAACACGGCACATTGCA
CAAAAATCACGCGCTGATGCCGAAAAAAACAGTGTTTGGATGTCAAACACCGGTTATGGCCGTGATTATGCTTCCGCACA
ATATCGCCGGTTTAGTTCGAAACGCACGCAAACACAAATCGGCATTGACCGCAGCTTGTCCGAAAATATGCAGATAGGCG
GAGTATTGACTTACTCTGACAGTCAGCATACTTTTGATCAGGCGGGCGGCAAAAATACTTTTGTGCAAGCCAACCTTTAT
GGTAAGTATTATTTAAATGATGCTTGGTATGTGGCCGGCGATATTGGTGCGGGCAGCTTGAGAAGCCGGTTACAAACGCA
GCAAAAAGCAAACTTTAACCGAACAAGCATCCAAACCGGCCTTACTTTGGGCAATACGCTGAAAATCAATCAATTCGAGA
TTGTCCCTAGTGCGGGTATCCGTTACAGCCGCCTGTCATCTGCCTGAAGAGCGCTCTTCAGCCGCTTACTTTGCCAATTA
TGGCAAAGGCGGCGTGAATGTGGGCGGTAAATCCTTCGCCTATAAAGCAGATAATCAACAGCAATATTCAGCAGGCGCCG
CGTTACTGTACCGTAATGTTACATTAAACGTAAATGGCAGTATTACAAAAGGAAAACAATTGGNAAAACAAAAATCCNGA
CAAATTAAAATACAGATTCGTTTCTAATAATACTAGTAGCGNCGCTGCAGTCCNGCAAAAAAGGGCAAGGTGTCACCACC
CTGCCCNTTTTCTTNNAACCGAAAGATACTTCGCGTATGCNNNTNNCGCTCACTGACTCGCTGCGCTNGNCGTCGCTGCN
GNNANNNNNCANNNNNNNNNNNNNAAAAANNNN