User:Maria Ines Goncalves/Notebook/Aulas Biologia Molecular 2010/2010/03/02

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Next entryResultset next.png

Exercício TP1

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

  • Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?

Podem ser representadas as moléculas de DNA e RNA, que constituem longas cadeias de nucleótidos. A molécula de DNA é formada por duas cadeias anti-paralelas e complementares tendo uma delas o sentido 5’→3’ e a complementar o sentido inverso (3’→5’). O nucleótido é formado por um grupo fosfato, uma desoxirribose e uma base azotada. As bases azotadas de adenina (A) e timina (T) e as bases guanina (G) e citosina (C) ligam respectivamente sempre entre si, sendo que as primeiras por 2 ligações de hidrogénio e as segundas por 3. A molécula de RNA diferencia-se por constituir uma cadeia simples, ter uma ribose em vez da desoxirribose presente no DNA e ainda por ter em vez das bases de timina (T) as bases de uracilo (U).


  • Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.

Para melhor representar a estrutura real poderiam ser indicadas as extremidades 5' e 3'(apesar de ser convenção) e o facto do DNA ser constituídos por cadeias anti-paralelas. Eventualmente poderiam ser esquematizadas as ligações de hidrogénio estabelecidas entre as diferentes bases.


  • Poderá esta sequência conter um gene? Justifique a sua resposta.

Poderá conter um gene no caso de se verificar um quadro de leitura, isto é, se ao longo da sequência existirem os codões de iniciação (AUG - Met) e Stop. Além disto terá de codificar um número de aminoácidos que possa constituir uma proteína. Pressupondo que a sequência em questão não está completa se se verificar um quadro de leitura aberto, isto é, sem codões de iniciação e stop, pode-se presumir que se trata de uma porção de um gene que pode codificar uma proteína.


  • Indique o resultado da transcrição desta sequência.

UUGACACUACCGAGGUGUACUAUUUUUACCCGAGUCGCUAAUUUUUGCCGCAAGGUGCUAAGCCGCGAGG AAAGCGAGGCUGAACAGGCAGUCGCCCGUCCACAGGUGACGGUGAUCCCGCGUGAGCAGCAUGCUAUUUC CCGCAAAGAUAUCAGUGAAAAUGCCCUGAAGGUAAUGUACAGGCUCAAUAAAGCGGGAUACGAAGCCUGG

É necessário ter em conta que a sequência pode ser transcrita segundo uma leitura da sequência apresentada e outra a partir da cadeia complementar anti-paralela.


  • É possível prever que proteína se encontra codificada numa sequência nucleotídica?

Como? É possível fazendo a leitura da sequência de bases, ou seja, atribuir a um codão o respectivo aminoácido utilizando o código genético. A sequência de aminoácidos obtida poderá corresponder a uma proteína.


  • A sequência apresentada codifica alguma proteína?

Consulte aqui o código genético

Utilizando o programa para fazer a tradução obtivemos os seguintes resultados:

5'3' Frame 1 L T L P R C T I F T R V A N F C R K V L S R E E S E A E Q A V A R P Q V T V I P R E Q H A I S R K D I S E N A L K V Met Y R L N K A G Y E A W


5'3' Frame 2 Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P


5'3' Frame 3 D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L


3'5' Frame 1 P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q


3'5' Frame 2 Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V


3'5' Frame 3 R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S

Dos resultados obtidos concluiu-se que 5'3' Frame 1 e 3'5' Frame 2 podem constituir uma porção de um proteína (mais de 20 aminoácidos), dado que não é apresentada a sequência completa não estão representados os codões de iniciação e stop.


  • Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?

No código standard o codão de iniciação é AUG, em bactérias está documentada a possibilidade de existirem os codões de iniciação GUG e UUG. Adicionalmente nas bactérias a iniciação pode ser atribuída a um codão NUG.


  • Como poderia saber de que organismo provém esta sequência?

Submeter a sequência a uma base de dados, por exemplo Blast, e esta por comparações indica o organismo a que poderá pertencer.