User:Lindenb/Notebook/UMR915/2012/03/02

From OpenWetWare
< User:Lindenb‎ | Notebook‎ | UMR915‎ | 2012‎ | 03
Jump to: navigation, search
Owwnotebook icon.png Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>      </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Daily

ExomeCNV

http://cran.r-project.org/web/packages/ExomeCNV/index.html

doc: https://secure.genome.ucla.edu/index.php/ExomeCNV_User_Guide

install:

mkdir lib

>  source("http://bioconductor.org/biocLite.R")
> biocLite("DNAcopy",lib="lib")

>  .libPaths("lib")
>  library("ExomeCNV",lib="lib")
Loading required package: DNAcopy

**************************************************************************
   The data format for the CNA object will be changed in version 1.23.0 
     Instead of a data frame it will be a list of 3 (or more) objects 
     chrom and maploc will be vectors and CN/LOH data will be a matrix 
**************************************************************************

and

http://genome.ucla.edu/~fah/ExomeCNV/script/makeCoverageScript.tar.gz

liftover hg18->hg19 : baitlibrary_information/Agilent_sanger_exome_0809_PCCR.bed


ERROR for the file bam2coverage.sh : it's a tar.gz not a sh:

  $ file src/bam2coverage.sh 
  src/bam2coverage.sh: gzip compressed data, from Unix, last modified: Thu Mar  1 23:49:58 2012

I mailed the author.


GATK and read groups

https://getsatisfaction.com/gsa/topics/the_unified_genotyper_complains_about_a_missing_read_group

http://www.broadinstitute.org/gsa/wiki/index.php/Frequently_Asked_Questions#How_can_I_tell_if_my_BAM_file_has_read_group_and_sample_information.3F

Duplicate in BAMs

$ ~/package/samtools-0.1.18/samtools view -F 4 -q 10 CD5121/CD5121_sorted.bam | awk -F ' ' '($3=="chr1" && $4=="3600741" && $8=="3600736")'

HTKZQN1_353:3:1204:6076:118387	145	chr1	3600741	254	100M	=	3600736	-105	CGCTGGACTGGTCAGCTGCTCGGCCCCGCCCACAGGCTGGCTGCCCCGCCCCGCCTCCGCCGCCCAGGGATTCGTAGGTGGGGAATTTGTTTGCGCTGCG	######################@BB@BB@<+48(<(88?0;58DB<5@B@<8?BB8@>8EIIIGHHEGIGGIGHDIGHEGGGHFEGIGHFHGFFDDD@@B	BC:Z:0	XD:Z:9C90	SM:i:403	AS:i:0
HWI-ST980_147:6:2107:5294:13481	83	chr1	3600741	254	100M	=	3600736	-105	CGCTGGCCTCGTCAGCTGCTCGCCCCCGCCCACGCGCTGGCTGCCCTGCCCCGCCTCCGCCGCCCAGGGATTCGTAGGTGGGGAATTTGATTGCGCTGCG	######################################?@@?<:0)&5-0-5?578;;9AIDIHF9HEHF?:)C<FEFEEBEHF?HEF?FFDD@DDB@@@	BC:Z:0	XD:Z:6A15G10AG11C42T10	SM:i:275	AS:i:637