User:Leonor Quintaneiro/Notebook/Aulas de BioMol/2010/04/27

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>      </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>

Aula TP6

Digestão de DNA com enzimas de restrição

As enzimas de restrição são o bisturi dos biologistas moleculares pois permitem “cortar” o DNA de um modo preciso e reprodutível.

As enzimas de restrição fazem parte do grupo das nucleases, enzimas que clivam ligações fosfodiester entre nucleótidos adjacentes. As enzimas de restrição usadas em biologia molecular têm a grande vantagem de clivarem apenas as ligações entre nucleótidos com uma sequência específica. Existem comercializadas perto de 100 enzimas de restrição, cada uma das quais reconhece e cliva uma sequência única de nucleótidos.

As enzimas de restrição identificam-se por uma nomenclatura própria. Por exemplo, EcoRI refere-se à primeira (I) enzima isolada do género Escherichia (E). espécie coli (co), estirpe RY13 (R) e Hind III à terceira enzima (III) isolada de Haemophilus influenzae, estirpe Rd.

Exercício 1 – Extremidades e ligações

Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

1. Que característica invulgar tem a sequência de reconhecimento destas enzimas?
Estas enzimas são palindrómicas, ou seja, a cadeia complementar a essas sequências vai ser igual à sequência de restrição dada se esta for lida de 5' para 3'. Neste caso podemos dizer que a enzima de restrição pode cortar em ambos os sentidos do DNA.
2. Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.
Bam HI :
5' G-----GATCC 3'
3' CCTAG-----G 5'


Hae II:
5' GG-----CC 3'
3' CC-----GG 5'


Eco RI:
5' G-----AATTC 3'
3' CTTAA-----G 5'


Bgl II:
5' A-----GATCT 3'
3' TCTAG-----A 5'

3. É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por: BamHI? EcoRI? BglII?
Apenas é possível com as extrimidades de BamHI e com a de BglII.

4. Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique.
Em média os ragmentos resultantes da digestão de DNA genómico com Bam HI serão maiores que os fragmentos resultantes da digestão com a Hae II, pois a sequência de reconhecimento da Bam HI é menos provável de acontecer (tem 6 nucleótidos na zona) do que a sequência da Hae II que tem apenas 4 nucleótidos.

Exercício 2 – Mapas de restrição

As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html


1. A que correspondem as bandas azuis no gel?
Ao azul bromofenol e ao cianol xileno.
2. Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê?
Para o PleI esperavamos 4 mas apenas vemos 3 pois dois dos fragmentos têm quase o mesmo tamanho, ficam sobrepostos no gel. Para o BgII esperávamos 3 fragmentos e observámos esse mesmo número de fragmentos.
3. Que papel tem a concentração de agarose na análise de fragmentos de restrição?
A concentração de agarose vai defenir o tamanho dos poros por onde passa a amostra e portanto vai definir a resolução a que esta electroforese é realizada.
4. Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo?
Para determinar de forma rigorosa o tamanho dos fragmentos observados realizaria primeiro, através dos fragementos dos marcadores de peso molecular, uma regressão logaritmica e, de seguida, através das fórmula calcularia o tamanho dos fragmentos da amostra.

BIOMOL LCS DadosTP6.jpg

Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

  1. Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?

Sim, pois quando a enzima EcoRI corta o genoma em 5 locais vao-se formar 6 fragmentos de DNA, daí a electroforese apresentar 6 bandas fluorescentes.

  1. Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas:
    1. Quantas moléculas de DNA estão na primeira e na última banda observadas no gel?

Considerando que 1 mol de bases é igual a 325g podemos calcular o número de moléculas na amostra no gel e, portanto, o número de moléculas de DNA em cada banda. Exitem 1,908x10^10 moléculas de DNA tanto na primeira banda como na última.

    1. Que quantidade de DNA está nas mesmas bandas?

Na primeira banda, que possui 21 227 pares de bases, estão 0,44 ug de DNA.
Na última banda, que possui 3 530 pares de bases, estão 0,072 ug de DNA.

Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:

  1. DNA x EcoRI = 5000 + 3000 + 2000
  2. DNA x HindIII = 5500 + 4500
  3. DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500
    1. Com base nesta informação, construa o mapa de restrição desta molécula.

Mapa de restrição: 5000 EcoRI - 500 HindIII -1500 EcoRI - 3000 end


Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:
#uma enzima de corte único; BAM HI
#uma enzima com dois cortes; AccB1I
#uma enzima que não corta neste DNA. AatI
(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)

Exercício 3 – Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações

As variações de sequência do genoma humano podem resultar na alterção de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense. Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.
1.Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI.
2.Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR.
Para o diagnóstico faria uma amplificação por PCR e, de seguida, trataria a zona através de enzimas de restrição. Em último lugar faria uma electroforese onde poderia nterpretar os resultados.
3.Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico).
N____________________H____________________D
...................................____..............................._____

____.............................____

____.............................____