User:Leonor Quintaneiro/Notebook/Aulas de BioMol/2010/04/20

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page
<html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html>      </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html>


PCR e RT-PCR

[edit] Introdução A técnica do PCR permite obter um grande número de cópias de uma sequência de DNA de interesse a partir de uma quantidade mínima de material. Nas aplicações de maior sensibilidade, uma única molécula de DNA pode ser suficiente para gerar milhões de cópias. Este é por issoo método base para um número muito grande de técnicas de diagnóstico molecular, incluindo em particular os diagnósticos que requerem sequenciação de DNA.

A seguinte animação explica o funcionamento da técnica: PCR

Quando é necessário proceder à caracterização da expressão de genes, é também possível aplicar a técnica de PCR acoplando-a a uma reacção de transcrição reversa, como explicado na seguinte animação: RT-PCR

Note que o resultado de um ensaio de PCR ou RT-PCR tem geralmente de ser visualisado por separação electroforética dos produtos de reacção.


Questões

Que características deve ter um primer de PCR?. Um primer deve ser complementar à sequência de DNA que pretendemos analisar, deve também ter um comprimento de cerca de 20 nucleótidos para que não haja o perigo deste se ligar a uma outra sequência de DNA que também seja semalhante (no caso de um primer mais curto) e, no caso de um primer muito comprido há o perigo deste não se vir a ligar com a sequência que pretendemos. Outra característica importante dos primers é o ratio de nucleótidos G's e C's face aos A's e T's: visto que as ligações entre G's e C's são de três pontes de hidrogénio estas vão ser mais fortes e, por isso, terá de se ter em atenção que este fenómeno pode levar o primer a ligar-se a uma sequência que não seja a que pretendemos e que não seja totalmente complementar. Por este motivo um primer deverá ter uma percentagem de 40-50% de G's e C's.

Como qualquer DNA polimerase, a transcriptase reversa requer um primer iniciador, que pode ser de 3 tipos distintos: específico de gene, oligo-dT ou random (uma mistura aleatória de 6 a 8 nucleótidos). Em que situações pode ser utilizado cada um destes primers e que vantagens/desvantagens relativas apresentam? So mRNA tiver uma cauda poly-A então um primer oligo-dT poderá ser usado simultaneamente em todos os mRNAs. No caso de se querer sequenciar um mRNA específico dever-se-à utilizar um primer específico de gene que apenas se irá ligar a uma sequência de mRNA. Um primer random é utilizado quando se está interessado em produzir pedaços de cDNA espalhados pelo mRNA, no entanto os cDNAs não terão o comprimento total. A vantagem deste processo é a produção de fragmentos curtos de cDNA e o aumento da probabilidade de pontas 5' de mRNAs serem convertidas em cDNA, algo difícil de alcançar devido ao facto da transcriptase reversa normalmente não conseguir chegar as pontas 5' de mRNAs longos.

Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo. Polymerase Chain Reaction (PCR): 1. Em primeiro lugar recolheria uma pequena amostra de células da mucosa bucal da familia do caso de estudo. 2. As amostras seram então aquecidas até

Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.


Para a expressão do gene da beta-globina propunha fazer-se um RT-PCR, de maneira a se poder fazer uma comparação entre as sequências obtidas com as que nãp possuem mutação. Esta técnica tem por base a utilização da transcriptase reversa que vai, através do mRNA, permitir obtermos cDNA para fazer a comparação.

Procedimento experimental:

1. Design dos primers para a reacção de RT: -RIGHT primer: CTTTCTTGCCATGAGCCTTC

2. Recolha da amostra biológica

3. Lise dos eritrócitos para obtenção do RNA

4. Preparar mix para reacção da RT:

  -RNA desnaturado
  -Solução tampão
  -dNTPs
  -MgCl2
  -Primers
  -Transcriptase reversa
  -Água

5. Design dos primers para a reacção de PCR:

  -LEFT primer: TCTGTCCACTCCTGATGCTG
  -RIGHT primer: CTTTCTTGCCATGAGCCTTC

6. Mix para PCR:

  -cDNA
  -Solução tampão
  -Taq polimerase
  -2 primers
  -dNTPs
  -Água

7. Depois do PCR realizar uma electroforese e, de seguida, interpretar os resultados.