User:Karmella Haynes/Notebook/BioBrick cloning/2010/06/05

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

06/05/10

  • ✓ Order primers: for Hygro amplification

Order Primers

> PCR insert: Hygromycin R gene from V0200 (new oligos with longer ends):

  1. Hygro f2 5'-tagcagacatagacaga gatgaggatc atg AAAAAGCCTGAACTCACCGC (has BsaBI and Met)
  2. Hygro r2 5'-cagccgaatcgcatcgacgcgtac ttcgaa CTATTCCTTTGCCCTCGGAC (has BstBI)