05/18/10
- ✓ Make MV7 (new vector): delete CMV promoter from pcDNA3.1+ neo
- ✓ Make MV3 (new vector, replace BART18): replace neo in pcDNA3.1+ with hygromycin (order reagents)
Make MV7 (pcDNA3.1+ neo ΔpCMV)
> Use MV1 (pcDNA3.1+ neo)
> Digest w/ SpeI to get rid of CMV promoter
> Digest (Fermentas FD)
Reagent |
Volume |
|
|
DNA (plasmid) |
5.0
|
10x buffer |
3.0
|
SpeI |
2.0
|
dH2O |
20
|
|
30 μL --> 37°C/ ~30 min.
|
> Measure conc.'s
Sample |
OD260 |
260/280 |
ng/μL
|
1. MV1 (S) |
1.015 |
1.94 |
50.8
|
> Ligations
Ligation |
Plate results (lig : neg crtl) 05/19/10
|
1. MV1(S)/4742, 25 ng |
MV7 #:1 (Pick #)
|
2. MV1(S)/4742, 25 ng (no ligase) |
MV7 10:1 (Pick 4)
|
|
1 |
2 |
|
Vector DNA |
0.5 |
0.5 |
|
2x lgn buf (Roche) |
5.0 |
5.0 |
|
T4 ligase (NEB) |
1.0 |
--- |
|
dH2O |
3.5 |
4.5 |
|
|
10 μL |
10 μL |
|
--> R.T./ ~10 min.; Add 50 μL Turbo DH5α (T-DH5α)
Make MV3 (pcDNA3.1+ hygro)
> Strategy
- Clone pcDNA3.1+ neo in Dam-, Dcm- strain (C2925, NEB) to get rid of CpG methylation (blocks BsaBI, BstBI)
- Cut Neomycin R gene from pcDNA3.1+ neo w/ BsaBI, BstBI (order enzymes)
- PCR insert: Hygromycin R gene from V0200 (order oligos):
- Hygro f1 5'-gatc gatgaggatc atg AAAAAGCCTGAACTCACCGC (has BsaBI and Met)
- Hygro r1 5'-gatc ttcgaa CTATTCCTTTGCCCTCGGAC (has BstBI)
|