User:Karmella Haynes/Notebook/BioBrick cloning/2010/05/18

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

05/18/10

  • ✓ Make MV7 (new vector): delete CMV promoter from pcDNA3.1+ neo
  • ✓ Make MV3 (new vector, replace BART18): replace neo in pcDNA3.1+ with hygromycin (order reagents)



Make MV7 (pcDNA3.1+ neo ΔpCMV)
> Use MV1 (pcDNA3.1+ neo)
> Digest w/ SpeI to get rid of CMV promoter


> Digest (Fermentas FD)

Reagent Volume  
DNA (plasmid) 5.0
10x buffer 3.0
SpeI 2.0
dH2O 20
  30 μL --> 37°C/ ~30 min.


> Measure conc.'s

Sample OD260 260/280 ng/μL
1. MV1 (S) 1.015 1.94 50.8


> Ligations

Ligation Plate results (lig : neg crtl) 05/19/10
1. MV1(S)/4742, 25 ng MV7 #:1 (Pick #)
2. MV1(S)/4742, 25 ng (no ligase) MV7 10:1 (Pick 4)
  1 2
Vector DNA 0.5 0.5
2x lgn buf (Roche) 5.0 5.0
T4 ligase (NEB) 1.0 ---
dH2O 3.5 4.5
  10 μL 10 μL

--> R.T./ ~10 min.; Add 50 μL Turbo DH5α (T-DH5α)



Make MV3 (pcDNA3.1+ hygro)
> Strategy

  • Clone pcDNA3.1+ neo in Dam-, Dcm- strain (C2925, NEB) to get rid of CpG methylation (blocks BsaBI, BstBI)
  • Cut Neomycin R gene from pcDNA3.1+ neo w/ BsaBI, BstBI (order enzymes)
  • PCR insert: Hygromycin R gene from V0200 (order oligos):
  1. Hygro f1 5'-gatc gatgaggatc atg AAAAAGCCTGAACTCACCGC (has BsaBI and Met)
  2. Hygro r1 5'-gatc ttcgaa CTATTCCTTTGCCCTCGGAC (has BstBI)