User:Jorge E. Buendia Buendia/Notebook/iGEM UNAM-Genomics-Mexico/2010/07/29

From OpenWetWare
Jump to: navigation, search
Igem-logo-150px.png iGEM UNAM-Genomics-Mexico Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

July 29th, 2010

1. Plate in solid LB medium TrpR mutant strains grown on July 28th.


2. Design reverse primer to amplify BBa_I20260: J23101 promoter + GFP BBa_E0040, the primer will anneal in the J23101-promoter region and will have a SpeI restriction site.

>Primer J23101 + SpeI REV

actagt gta gctagcataatacctaggactgagctagc

Primer has 6bp of SpeI restriction site, 3bp of separation between restriction site and promoter, and 29bp of J23101.