User:Jorge E. Buendia Buendia/Notebook/iGEM UNAM-Genomics-Mexico/2010/07/29
From OpenWetWare
iGEM UNAM-Genomics-Mexico | Main project page Previous entry Next entry |
July 29th, 20101. Plate in solid LB medium TrpR mutant strains grown on July 28th.
>Primer J23101 + SpeI REV actagt gta gctagcataatacctaggactgagctagc Primer has 6bp of SpeI restriction site, 3bp of separation between restriction site and promoter, and 29bp of J23101.
|