User:Iolanda S. O. Santos/Notebook/Caderno de Apontamentos/2010/03/16

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Exercício TP3

  • Questões

O que é necessário para fazer uma reacção de sequenciação? Primer (~20 nucleotidos), DNA polimerase, 4 dNTPs, didNTPs, DNA (cadeia molde)


Que cadeia é sequenciada? complementar da cadeia molde

Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?

carbono 5'do dNTP liga-se ao carbono 3' no final da cadeia que permite a polimerização. Com a adição dos didNTPs (nucleotidos modificados - não possuem OH 3') a elongação é terminada, isto é, o nucleotido seguinte não poderá ligar-se (não há formação da ligação fosfodiester).

Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?

Os dNTPS são nucleotidos que consegeum emparelhar e que possuem o grupo OH 3' permitindo a formação da ligação fosfodiester com o nucleotido seguinte.

Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?

A intensidade dos picos varia mesmo comparando com o mesmo nucleotido - reacção de sequenciação já não consegue formar fragmentos de maior dimensão, porque os nucleotidos são incorporados aleatoriamente e é mais dificil a DNA polimerase chegar mais longe; são assim produzidos muitos fragmentos de menor dimensão. A eletroforese tem influencia na separaçao dos picos (é mais facil separar um fragmento de 100pb de um de 101pb do que separar um de 500pb de 501pb). à medida k caminhamos + para 3’ as intensidades vão diminuindo (altura e largura) - esgotam-se os "reagentes" (didNTPs) sítios com N (pode ser base qq)- a análise torna-se menos rigorosa

O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?

Partir o fragmento completo em fragmentos de 600 – 1000 nucleotidos usando endonucleases de restrição.

Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?

Individuo 1 - TCGTGTTCTATGATCATGAGAGTCGCCG

Individuo 2 - TCGTGTTCTATGCTCATGAGAGTCGCCG existem dois picos (azul e preto) sobrepostos


Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?

Relativamente ao mRNA, isolava-se dos eritrócitos, fazer transcrição reversa obtendo cDNA e utilizando um primer complementar do início da sequência. Em relação ao DNA utiliza-se um primer complementar e sequencia-se.

Considere os resultados da sequenciação discutida no Caso de Estudo 1. Que aspecto esperaria encontrar no electroferograma na região variável de cada indivíduo?

Na região variável os pais da maria apresentam picos de cores diferentes, correspondentes a duas mutações/polimorfismos. No electroferograma da maria pode-se observar os picos correspondentes à mutação/polimorfismo da mãe e à mutação/polimorfismo do pai.

Se tivesse apenas acesso aos resultados da sequenciação da Maria, seria capaz de definir o seu genótipo com rigor? Justifique.

Seria possível definir a sequencia, no entanto sem comparação com o resultado dos pais não saberíamos se teria ocorrido alguma mutação/polimorfismo.

Com base na sequência do gene da beta-globina disponível na última TP e as técnicas de análise de sequências que tem vindo a aprender identifique as regiões do gene em que se localizam as alterações pontuais encontradas.

Se a sequenciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?

Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?

(Overlapping). Sequenciar de um lado e do outro e criar fragmentos sobreponíveis.