User:Hattie Chung/Notebook/Intron Expression of mStaple/2010/01/11

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Entry title

Intron will be inserted between positions 2813 and 2814 on the original mKate plasmid (not renumbered)

PCR Primers

Exon1fwd:

  • 5’-AAGCTAACCGGTCGCCACCATGGTGTCTAAG-3’
  • Length 31; GC 57.9%; Tm 55.8C (65.9C, entire oligo)
  • Extra sequences
  • AgeI Site
  • Kozak sequence and mKate 2537 – 2562

Exon1rev1:

  • 5’-GCACCCGCCATCCAGCCTGTCCTTTGGACCACTTACCTCAGGGAAGGACTGCTTAAAG -3’
  • Length: 58; GC 50.0%; Tm 55.1C (64.5C, entire oligo)
  • First half of mStaple
  • Reverse-complement of GTAAGT (Donor Site)
  • Reverse Complement of mKate 2792-2813

Exon1rev2:

  • 5’-CTAATGCTCGAGAGTTAGTACCACGCCCACGCCGATGCACCCGCCATCCAGCC-3’
  • Length: 53; GC 76.5%; Tm 62.9C
  • Extra Sequences
  • XhoI site
  • Branch Point, Reverse Complement
  • Second half of mStaple
  • Reverse complement of portion of First half of mStaple

Exon2fwd:

  • 5’-CAGGAGCTCGAGTCTTCTTTTTTTTTTTCACAGGGCTTCACATGGGAGAGAG-3’
  • Length 52; GC 57.9%; Tm 55.1C (66.4C, entire oligo)
  • Extra Sequences
  • XhoI site
  • Poly-Pyrimidine Tract
  • Acceptor Site
  • mKate 2814-2832

Exon2rev1:

  • 5’-GTACTTGCGGCCGCTCAATTAAGTTTGTGCCCCAG-3’
  • Extra Sequences
  • NotI site
  • Reverse Complement of mKate 3236 – 3257
  • Length 35; GC 40.0%; Tm 56.4C (67.4C, entire oligo)

mKate no mStaple negative control:

  • PCR with Exon1fwd + Exon2rev

Gata3 mStaple (Length 66 bp): 5’- AAGCTTGGTCCAAAGGACAGGCTGGATGGCGGGTGCATCGGCGTGGGCGTGGTACTAACTCTCGAG-3’

HindIII site, Gata3 mStaple, Branch Point, XhoI site

Reverse Complement: 5’-CTCGAGAGTTAGTACCACGCCCACGCCGATGCACCCGCCATCCAGCCTGTCCTTTGGACCAAGCTT-3’