User:Goncalo Correia/Notebook/BIOMOL/2010/03/02

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Next entryResultset next.png

TP 1

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

   * Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos? 

DNA, RNA ou proteína. As convenções implícitas neste caso (DNA) serão que se trata da cadeia codificante (5' -> 3'), e que A=Adenina, T=Timina, G=Guanina, C=Citosina. No caso do RNA passamos a ter U (uracilo) em vez de T e no caso das proteínas em vez dos nucleótidos teremos aminoácidos, representados por letras individuais ou as 3 letras iniciais (ex: Metionina representada por M ou Met).

   * Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real. 

Um esquema da Dupla Hélice, representar as duas cadeias (5'-3' e 3'-5') com as bases emparelhadas.

   * Poderá esta sequência conter um gene? Justifique a sua resposta. 

Depois de feita a transcrição, podemos constatar que nesta sequência, dependendo da posição da grelha de leitura, temos codões de iniciação e codões de STOP (ORF's), o que indica que a sequência pode conter informação para um péptido. Apesar disto, mesmo na ausência de codões de iniciação e de STOP não poderíamos descartar esta hipótese, uma vez que a sequência é relativamente pequena e podia codificar apenas parte do péptido/proteína.

   * Indique o resultado da transcrição desta sequência. 

Assumindo as convenções implícitas citadas anteriormente: UUGACACUACCGAGGUGUACUAUUUUUACCCGAGUCGCUAAUUUUUGCCGCAAGGUGCUAAGCCGCGAGGAAA GCGAGGCUGAACAGGCAGUCGCCCGUCCACAGGUGACGGUGAUCCCGCGUGAGCAGCAUGCUAUUUCCCGCAAAGA UAUCAGUGAAAAUGCCCUGAAGGUAAUGUACAGGCUCAAUAAAGCGGGAUACGAAGCCUGG

   * É possível prever que proteína se encontra codificada numa sequência nucleotídica? 

Como?

Sim, depois de escolher uma grelha de leitura podemos usar o código genético para transcrever a sequência.

   * A sequência apresentada codifica alguma proteína? 

Com o código genético standard: 5'3' Frame 1 L T L P R C T I F T R V A N F C R K V L S R E E S E A E Q A V A R P Q V T V I P R E Q H A I S R K D I S E N A L K V Met Y R L N K A G Y E A W

5'3' Frame 2 Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P

5'3' Frame 3 D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L

3'5' Frame 1 P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q

3'5' Frame 2 Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V

3'5' Frame 3 R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S

Dependendo da grelha de leitura, do sentido (5'-3' ou inverso) e do código genético usado, vamos ter situações diferentes. Podemos ter péptidos como Met L L T R D H R H L W T G D C L F S L A F L A A Stop. Na ausência de um codão de iniciação não podemos descartar a hipótese de ser parte da sequência de uma proteína com um tamanho maior do que a sequência representada.

   * Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana? 

Além do codão de iniciação AUG, a translação pode também começar em codões NUG (principalmente UUG e GUG). Isto pode permitir mais hipóteses de sequências peptídicas do que as contempladas com o código standard.


   * Como poderia saber de que organismo provém esta sequência? 

Utilizar uma ferramenta de alinhamento (ex: BLAST) para comparar com sequências armazenadas em bases de dados.