User:Gabriela Santos/Notebook/GabrielaSantos BIOMOL/2010/04/20

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Entry title

  • PCR e RT-PCR

[edit] Introdução A técnica do PCR permite obter um grande número de cópias de uma sequência de DNA de interesse a partir de uma quantidade mínima de material. Nas aplicações de maior sensibilidade, uma única molécula de DNA pode ser suficiente para gerar milhões de cópias. Este é por issoo método base para um número muito grande de técnicas de diagnóstico molecular, incluindo em particular os diagnósticos que requerem sequenciação de DNA.

A seguinte animação explica o funcionamento da técnica: PCR

Quando é necessário proceder à caracterização da expressão de genes, é também possível aplicar a técnica de PCR acoplando-a a uma reacção de transcrição reversa, como explicado na seguinte animação: RT-PCR

Note que o resultado de um ensaio de PCR ou RT-PCR tem geralmente de ser visualisado por separação electroforética dos produtos de reacção.



[edit] Questões Que características deve ter um primer de PCR?. Como qualquer DNA polimerase, a transcriptase reversa requer um primer iniciador, que pode ser de 3 tipos distintos: específico de gene, oligo-dT ou random (uma mistura aleatória de 6 a 8 nucleótidos). Em que situações pode ser utilizado cada um destes primers e que vantagens/desvantagens relativas apresentam? Proponha com detalhe adequado um procedimento experimental que permita a identificação das mutações presentes no gene da beta-globina na família do nosso caso de estudo.


Proponha com detalhe adequado um procedimento experimental que permita o estudo da expressão do gene da beta-globina na família do nosso caso de estudo.

Cadeia codante (5’->3’) do gene beta globina

CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGA AGATATGCTTAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATAT TCTGGAGACGCAGGAAGAGATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAAC TCTTCCACTTTTAGTGCATCAACTTCTTATTTGTGTAATAAGAAAATTGGGAAAACGATCT TCAATATGCTTACCAAGCTGTGATTCCAAATATTACGTAAATACACTTGCAAAGGAGGATG TTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATATCTTAGAGGGAGGGCT GAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTC ATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGC AGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACAT TTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACT CCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTG GTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAA CTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTCTCTCTGCCT ATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTC TTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGG CTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACC TCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGA TCCTGAGAACTTCAG'GGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCT TTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAGAGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGGCTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTATTTCTGAATATTTTACTAAAAAGGGAATGTGG

A seguinte sequência corresponde ao mRNA da beta-globina: ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA


EXON Genomic coordinates mRNA coordinates Length Identity

Exon 1

                546-687	      1-142	          142	     100.0%

Exon 2

                818-1040	      143-365	          223	     100.0%

Exon 3

                1891-2155	      366-630	          265	     99.2%

Depois da análise da sequência do gene foram encontradas 2 mutações, uma localizada no 2º exão e outra no 2ºintrão.

1ª Mutação localizada dentro do exão que leva ao aparecimento de um codão stop prematuro: 462 (substituição T->A), a partir do inicio da transcrição ou corresponde a posição 1008 da sequência fornecida dentro do 2ºexão.

2ª Mutação localizada dentro do intrão que leva ao splicing prematuro: 732 (substituição T->G), a partir do inicio da transcrição ou corresponde a posição 1278 da sequência fornecida dentro do 2ºintrão. (A amarelo o exão 2. A cinzento o intrão 2)

Através do Blast primer procuramos os melhores primers que permitem amplificar a sequência do gene onde se encontram as nossas mutações. Não precisamos de amplificar o gene inteiro por ser um processo desnecessário e alem disso quanto maior for o fragmento a sequenciar mais caro sai. Como já conhecemos a posição das nossas mutações de interesse, que até se encontram próximas uma da outra no gene, basta amplificar a partir de alguns pares de bases antes da 1ª mutação ou do inicio do 2ºexão, até a algumas pares de bases depois da 2ª mutação ou em alternativa até ao fim do 2ºintrão. Neste caso os primers que escolhi são aqueles que têm um Tm à volta de 60 o que dá maior estabilidade à ligação e resulta numa amplificação mais especifica.

Obtiveram-se estes 2 tipos de primers, que possibilitam amplificar a zona de interesse: Sequence (5'->3') Forward primer: GGCCTGGCTCACCTGGACAAC Reverse primer: GCAAAAGGGCCTAGCTTGGACTCA tamanho do produto amplificado: 908

ou

Forward primer: GCCTGGCTCACCTGGACAACC Reverse primer: GCAAAAGGGCCTAGCTTGGACTCA tamanho do produto amplificado : 907