User:Gabriel A. Suarez/Notebook/ADP1 Baylyi reference

From OpenWetWare
Jump to: navigation, search

<!-- sibboleth --><div id="lncal1" style="border:0px;"><div style="display:none;" id="id">lncal1</div><div style="display:none;" id="dtext"></div><div style="display:none;" id="page">User:Gabriel A. Suarez/Notebook/ADP1 Baylyi reference</div><div style="display:none;" id="fmt">yyyy/MM/dd</div><div style="display:none;" id="css">OWWNB</div><div style="display:none;" id="month"></div><div style="display:none;" id="year"></div><div style="display:none;" id="readonly">Y</div></div>

Owwnotebook icon.png <sitesearch>title=Search this Project</sitesearch>

Customize your entry pages Help.png

Tdk/kan sequence as used by Berardinis et al., 2008.

5’ - CCCAGCCTCCAATTCAAATCATAAAAAATTTATTTGCTTTATTAAAGAGGAGAAATTAATTAATGGCACAGCTATATTTCTACTATTCCGCAATGAATGCGGGTAAGTCTACAGCATTGTTGCAATCTTCATACAATTACCAGGAACGCGGCATGCGCACTGTCGTATATACGGCAGAAATTGATGATCGCTTTGGTGCCGGGAAAGTCAGTTCGCGTATAGGTTTGTCATCGCCTGCAAAATTATTTAACCAAAATTCATCATTATTTGATGAGATTCGTGCGGAACATGAACAGCAGGCAATTCATTGCGTACTGGTTGATGAATGCCAGTTTTTAACCAGACAACAAGTATATGAATTATCGGAGGTTGTCGATCAACTCGATATACCCGTACTTTGTTATGGTTTACGTACCGATTTTCGAGGTGAATTATTTATTGGCAGCCAATACTTACTGGCATGGTCCGACAAACTGGTTGAATTAAAAACCATCTGTTTTTGTGGCCGTAAAGCAAGCATGGTGCTGCGTCTTGATCAAGCAGGCAGACCTTATAACGAAGGTGAGCAGGTGGTAATTGGTGGTAATGAACGATACGTTTCTGTATGCCGTAAACACTATAAAGAGGCGTTACAAGTCGACTCATTAACGGCTATTCAGGAAAGGCATCGCCACGATTAACGGCCGCCACCGCGGTGGAGCTCGGTACCCGGGGATCCTCTAGAGCGGACCCG GGAAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATAC AAGGGGTGTT ATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCACTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAA GCATGCGGAGCTGG - 3’

[Download file] with complete details on tdk/kan sequence.

Recently Edited Notebook Pages