User:Eric M. Walters/Notebook/Spring 2012/2012/05/14

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.pngCyanobacterial acrylate production Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Starting project: examining utility of the acsA+acrylate counterselection method

Jumping ahead to engineering 3HP production without nailing this down isn't the way go about it. Need to figure out the numbers for how effective this method is. Gonna insert the random barcode sequence TCGTGTACAGGTAGACCGGGCATGCCTTCGTAATAAGGAT between the acsA-up & -down regions, knock it out

  • Ordered primers:
    • acsA-dnF-XbaI CCC TCTAGA GCGCTCAAGTTGATCGAATGTATG
    • acsA-dnF-BCback-SphI CCC GCATGCCTTCGTAATAAGGAT GCGCTCAAGTTGATCGAATGTATG
    • acsA-UpR-BCfront-SphI CCC GCATGCCCGGTCTACCTGTACACGA GTTCGTTTCAATGAAGGCGAAAC
    • ΔacsA-barcode-F AACTCGTGTACAGGTAGACCG