User:Elaine Marie Robbins/Notebook/CHEM-496/2011/10/12

Conductivity of AuNP II, DNA Sequencing

Main project page Previous entry      Next entry

Objective Conductivity of AuNP II To repeat the experiment on 10/11/11 and make electrodes to test the conductivity of MBP protein fibers containing AuNPs using a four point probe. DNA Sequencing To compare the mutant GFP DNA sequence purified on 10/05/11 to the wild type GFP DNA sequence to determine if the mutation is present. Description Conductivity of AuNP II Glue Pd wire onto Pd foil using conductive epoxy. Heat with heat gun until epoxy dries. Repeat with 3 more wires/foils. Glue wires/foils to Teflon plate with Instant Krazy Glue. When dry, plate AuNP-containing protein fibers onto the Teflon across the Pd foils. Allow the solvent to evaporate overnight. DNA Sequencing Compare the obtained DNA sequence of GFP to the wild type DNA sequence from Invitrogen Data Conductivity of AuNP II Areas of Pd foil used, from left to right: 35.20 mm2, 41.16 mm2, 40.18 mm2, 38.64 mm2. DNA Sequencing Obtained DNA sequence of mutant GFP, mutation site bold and underlined: NNNNNNNNNNNTTTGTTNNACTTTAAGAAGGAGNTATACATATGCGGGGTTCTCATCATCATCATCATCATGGTATGGCTAGCAT GACTGGTGGACAGCAAATGGGTCGGGATCTGTACGACGATGACGATAAGGATCGATGGGGATCCGAATTCGCCACCATGGTGAGC AAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCG GCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC CCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCC ATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGG GCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAA CTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGACCCGCCACAACATCGAG GACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACC TGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGAT CACTCTCGGCATGGACGAGCTGTACAAGTAACTCGAGAAGCTTGATCCGGCTGCTAACAAAGCCCGAAAGGAAGCTGAGTTGGCT GCTGCCACCGCTGANCAATAACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACT The DNA sequence at the mutation site is identical to the wild type sequence. Therefore, the DNA was not mutated as intended. Notes Conductivity of AuNP II Electrodes made on 10/11/11 were not functional because the conductive epoxy used did not successfully glue the Pd foil and wire to the Teflon surface. DNA Sequencing It was determined that the primers used to create the mutation in the GFP DNA sequence actually coded for the wild type GFP sequence. Thus, no mutation was possible.