User:David K. Barclay/Notebook/Controlling Pancreas Cell Fate Using Transcription Factors/2014/10/27

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Cell Fate Switch by Synthetic Transcription Factors Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

New Primers

PRIMERS LIST
  Roche Name Left Primer Right Primer UPL probe
INS1 NM_008386.3 cagagaggaggtactttggactataaa gccatgttgaaacaatgacct 105, cat.no. 04692241001
NKX6-1 NM_144955.2 cccggagtgatgcagagt gaacgtgggtctggtgtgtt 103, cat.no. 04692217001
MNX1 NM_019944.2 gatgccggacttcagctc agctgctggctggtgaag 60, cat.no. 04688589001
SLC30A8 NM_172816.3 gctgcttcagcaatatgcttc cagactcccagcaacgtgt 53, cat.no. 04688503001
KLF9 NM_010638.4 ctcagaactgcttttaacattaggg aacactttcctttttagctcgtg 32, cat.no. 04687655001
PCSK2 NM_008792.4 ggcgtgtttgcattagcttt gcacagtcagatgttgcatgt 85, cat.no. 04689097001

OTHER: Plasmid Verification of PcTFs

Restriction Digest Table

  • Checked plasmid minipreps with EcoRI/PstI digests
Reagent Volume Expected:
1. hPCD = 1921 bp, 4592 bp
Today's gel
15 μL/lane; 1% agarose; Ladder
DNA(plasmid) 5.0 μL
10X FD Buffer 1.5
EcoRI 1.0
PstI 1.0
dH2O 6.5
  15 μL --> 37°C/ 15 min.

Conclusion All bands at ~4900 and ~2000; indicating MV2 vector and PcTF insert, respectively.