User:David Johnston Monje/Notebook/Maize Endophyte Biofertilizers/2011/11/18

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Applied Soil Microbial Ecology Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Remains of the Day

  • start water/ibr/actigard treatment of tomatoes
  • Fungal ITS analysis is proving difficult (either no amplification, or plant DNA amplification) - maybe need to go for nested reaction using primers NSA3: AAACTCTGTCGTGCTGGGGATA and NLC2: GAGCTGCATTCCCAAACAACTC from that company publication --> http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1156903/ .
  • testing fungal ITS primers again. This time gonna test out ITS1F/ITS4 and ITS5/ITS4Oo on Can Soil/Mex soil, tomato and potato RNA/DNA, 2 SantaMaria Soil samples, and 2 grafted tomato plant rhizosphere samples (8202 & 8205). 48 degree anealing, 40 cycles. As you can see below, there really is a problem - gonna have to opt for that nested approach....

File:Nov18,2011Gel.tif