User:Burak Yilmaz/Notebook/YR10 protein interaction/2009/09/09

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png YR10 Protein interaction Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Triticum aestivum stripe rust resistance protein Yr10

  • F primer
GGATTAATTAAATGGACTACAAGGACGACGATGACAAAGTCAAGCTTCTC

GAGAATTCCGAGGTCGTGACCGGGGCG

  • LENGTH:77
  • GC CONTENT:49.4 %
  • MELT TEMP:70.9 ºC
  • MOLECULAR

WEIGHT:23927.5 g/mole

  • R primer
GGTGCGGCCGCTCAGCGTGGAGTTACCTTCACCGTCAGTGT
  • LENGTH:41
  • GC CONTENT:63.4 %
  • MELT TEMP:73.2 ºC
  • MOLECULAR

WEIGHT:12625.2 g/mole