User:Burak Yilmaz/Notebook/YR10 protein interaction/2009/08/31

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Next entryResultset next.png

Primer design for arabidopsis GCN2 gene

forward primer

  • 5' GGATTAATTAAATGGACTACAAGGACGACGATGACAAAGTCAAGCTTCTCGAGAATTCCGGTCGCAGCAGTTCGAAGAAAAAGAAGAA 3'
  • LENGTH: 77
  • GC CONTENT: 45.5 %
  • MELT TEMP: 69.9 ºC
  • MOLECULAR
  • WEIGHT: 23870.5 g/mole

reverse primer

  • 5' GGTGCGGCCGCTTAGCTCCAAACAGAGGGGTTTCTAAATTG 3'
  • LENGTH: 41
  • GC CONTENT: 53.7 %
  • MELT TEMP: 68.8 ºC
  • MOLECULAR
  • WEIGHT: 12681.2 g/mole
  • TTAATTAA PacI site
  • GACTACAAGGACGACGATGACAAA Flag tag
  • GCGGCCGC   NotI site