User:Brady P. Dennison/Notebook/Notebook/2015/10/27

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Oligo Primer Creation for Sequencing

Sequence Required for Reverse Primer of mCherry:
F primer for the KAH60/pcVN ggtcaaagacagttgactgtatcgc

Used the Website: https://www.idtdna.com/site
Total Cost:
$9.25

Used the Following Concentrations for Sequencing:
1 μL of DNA (208 ng/μL Concentration
1 μL of Forward Primer
8 μL of Water

Took Tube to be sequenced to DNA ASU