User:Anugraha Raman/Notebook/iGEM 2010/2010/06/23

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Wednesday June 23, 2010

amiRNA

amiRNA pcr diagram
    • Go to the [amiRNA section] for our primers for this multi step PCR or see chart below:


Description Forward (A) Reverse (B)
biobrick RS300 CCTTGAATTCGCGGCCGCATCTAGA CCCACAAACACACGCTCGGA AAGGCTGCAGCGGCCGCTACTAGT CCCCATGGCGATGCCTTAAA


Description Primer 1 (mir sense) Primer 2 (mir antisense) Primer 3 (mir* sense) Primer 4 (mir* antisense)
GFP gaTTAGTGGTCGGCGAGCTGCACtctctcttttgtattcc gaGTGCAGCTCGCCGACCACTAAtcaaagagaatcaatga gaGTACAGCTCGCCGTCCACTATtcacaggtcgtgatatg gaATAGTGGACGGCGAGCTGTACtctacatatatattcct
LTP 1 gaTCTAACTATGTATAGGACCACtctctcttttgtattcc gaGTGGTCCTATACATAGTTAGAtcaaagagaatcaatga gaGTAGTCCTATACAAAGTTAGTtcacaggtcgtgatatg gaACTAACTTTGTATAGGACTACtctacatatatattcct
Bet v1 gaTTGGTTATATATATCGCACCTtctctcttttgtattcc gaAGGTGCGATATATATAACCAAtcaaagagaatcaatga gaAGATGCGATATATTTAACCATtcacaggtcgtgatatg gaATGGTTAAATATATCGCATCTtctacatatatattcct


Transformations

  • Transformed ligations (V0210+LTP1) (V0210+Ger 3 sense) (V0210+Ger 3 antisense)w/turbo cells
  • Grew up colonies w/ RS300 for minipreps