User:Ana Matos/Notebook/Aulas de BioMolecular/2010/04/27

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Aula 6

Digestão de DNA com enzimas de restrição

As enzimas de restrição são o bisturi dos biologistas moleculares pois permitem “cortar” o DNA de um modo preciso e reprodutível.

As enzimas de restrição fazem parte do grupo das nucleases, enzimas que clivam ligações fosfodiester entre nucleótidos adjacentes. As enzimas de restrição usadas em biologia molecular têm a grande vantagem de clivarem apenas as ligações entre nucleótidos com uma sequência específica. Existem comercializadas perto de 100 enzimas de restrição, cada uma das quais reconhece e cliva uma sequência única de nucleótidos.

As enzimas de restrição identificam-se por uma nomenclatura própria. Por exemplo, EcoRI refere-se à primeira (I) enzima isolada do género Escherichia (E). espécie coli (co), estirpe RY13 (R) e Hind III à terceira enzima (III) isolada de Haemophilus influenzae, estirpe Rd.


Exercício 1 – Extremidades e ligações

Considere as seguintes enzimas e respectivas sequências de restrição ( o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

1.Que característica invulgar tem a sequência de reconhecimento destas enzimas? Ao fazermos a cadeia complementar destas sequências notamos que o lugar de corte das enzimas se lê igual no sentido 5'->3' e 3'->5'. Essas enzimas de restrição tipo II são chamadas polindrómicas, assim a enzima pode actuar nos 2 sentidos.

2.Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.

Bam HI:

        ------G                     G A T C C------ 
        ------C C T A G                     G------ 

Hae II:

        ------G G                         C C------
        ------C C                         G G------

EcoRI:

        ------G                     A A T T C------
        ------C T T A A                     G------

Bgl II:

        ------A                     G A T C T------
        ------T C T A G                     A------

3.É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por: BamHI? EcoRI? BglII? É possivel ligar a Bam HI com ela própria e com a BglII.

4.Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique. A Bam HI dará segmentos maiores do que a Hae II, pois é mais provavel encontrar no genoma humano lugares de corte GG|CC que são de 4 nucleótidos do que lugares de corte G|GATCC com 6 nucleótidos. Logo, se é mais cortado no GG|CC (Hae II) os fragmentos serão menores.


Exercício 2 – Mapas de restrição

As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html


1.A que correspondem as bandas azuis no gel? Correspondem ao corante que usamos na electroforese (azul de bronofenol e cianol xileno) para ter a certeza que já colocamos a amostra no poço e para controlar a migração.

2.Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê? Para o PleI esperava 4 fragmentos e vemos 3. Para o BglI esperavamos 3 fragmentos e vemos 3. Provavelmente (e é preceptivel no esquema do plasmideo) 2 dos fragmentos do PleI são de tamanho semelhante, e por isso estão sobrepostos no gel.

3.Que papel tem a concentração de agarose na análise de fragmentos de restrição? A concentração vai definir o tamanho dos poros, assim podemos controlar a migração dependendo do que pretendemos.

4.Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo? Tendo um marcador molecular e comparando a migração do nosso DNA podemos fazer uma regressão logaritmica e saber o peso molecular dos nossos fragmentos pois o peso no marcador e migração é conhecido.


Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

1.Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê? Sim. A enzima EcoRI corta o genoma em 5 locais, logo o resultado serão 6 fragmentos (6 bandas), tal como vemos na electroforese.

2.Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas: 1.Quantas moléculas de DNA estão na primeira e na última banda observadas no gel? O numero de moléculas de DNA é igual na primeira e ultima banda. Se o DNA lambda tem 31.6x10^5 daltons e 1 dalton tem 1.66x10^-27 gramas, o DNA lambda terá aproximadamente 10^-21 gramas = 10^-15 microgramas. Portanto num micrograma de DNA existem aproximadamente 10^15 moléculas de DNA.

2.Que quantidade de DNA está nas mesmas bandas? Na primeira banda existem 440ng e na segunda banda 73ng.


Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:


1.DNA x EcoRI = 5000 + 3000 + 2000 2.DNA x HindIII = 5500 + 4500 3.DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500 1.Com base nesta informação, construa o mapa de restrição desta molécula.


Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

1.uma enzima de corte único; A enzima AccI.

2.uma enzima com dois cortes; A enzima AleI.

3.uma enzima que não corta neste DNA. A enzima AatII.

(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)



Exercício 3 – Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações

As variações de sequência do genoma humano podem resultar na alterção de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense.

Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.

1.Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI. 2.Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR. 3.Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico).