User:Ana Matos/Notebook/Aulas de BioMolecular/2010/03/02

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Next entryResultset next.png

Aula 1

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos? Moléculas de DNA, RNA. Não se muda a T para U.

Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real. Representação com complementaridade(cadeia dupla) com informação das cadeias 5´->3´ e 3' ->5´.

Poderá esta sequência conter um gene? Justifique a sua resposta. Sim. Contém o codão de iniciação meteonina(ATG), logo codifica uma proteína. Tem de ter um quadro de leitura aberto.

Indique o resultado da transcrição desta sequência. Mudamos a sequencia codificante(5´->3') de T para U. Na sequencia complementar fazemos a complementariedade mas do fim para o inicio(ou seja, no sentido 5'->3' também).

É possível prever que proteína se encontra codificada numa sequência nucleotídica? Como? Sim. Iniciamos a leitura no codão de iniciação e depois de 3 em 3 nucleotidos vemos que codão corresponde a cada proteína.

A sequência apresentada codifica alguma proteína? Codifica a proteína: Met Y R L N K A G Y E A W Stop, assumindo que é um código eucariótico.

Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana? Vendo o código de transcrição 11(bacteriano) o inicio da sequencia é logo UUG, portanto começando logo com iniciação da meteonina, assim as proteínas transcritas serão diferentes.

Como poderia saber de que organismo provém esta sequência? Poderiamos fazer um BLAST.