User:Ana Luisa Van Innis/Notebook/Caderno BioMol/2010/03/10

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Entry title

  • Insert content here...



Gene e mRNA

A sequência do genoma humano apresentada abaixo provém do cromossoma 11 e contém o gene da beta-globina:


CACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATAAGGAGAAGATATGCT TAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTTTGCATATTCTGGAGACGCAGGAAGA GATCCATCTACATATCCCAAAGCTGAATTATGGTAGACAAAACTCTTCCACTTTTAGTGCATCAACTTCT TATTTGTGTAATAAGAAAATTGGGAAAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTAC GTAAATACACTTGCAAAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATA TCTTAGAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTAC GGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAGGAGCAG GGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGAC ACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGAGGAGAAGTCTGCCGT TACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGCAGGTTGGTATCAAGG TTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTG ATAGGCACTGACTCTCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGA CCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAA GGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACC TTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTAT GGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTCATGTCATAGGAAGGGGATAAGTAA CAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGT TTCTTTTATTTGCTGTTCATAACAATTGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCC GCAATTTTTACTATTATACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATT AAGTAACTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCTTATT TGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATCATTATACATATTTA TGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAATCAGGGTAATTTTGCATTTGTAAT TTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTTGTTTATCTTATTTCTAATACTTTCCCTAATCTCT TTCTTTCAGGGCAATAATGATACAATGTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAAT TTCTGGGTTAAGGCAATAGCAATATCTCTGCATATAAATATTTCTGCATATAAATTGTAACTGATGTAAG AGGTTTCATATTGCTAATAGCAGCTACAATCCAGCTACCATTCTGCTTTTATTTTATGGTTGGGATAAGG CTGGATTATTCTGAGTCCAAGCTAGGCCCTTTTGCTAATCATGTTCATACCTCTTATCTTCCTCCCACAG CTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCACCCCACCAGTGCAGG CTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCACTAAGCTCGCTTTCT TGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACTGGGGGATATTATGAA GGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAATGATGTATTTAAATTAT TTCTGAATATTTTACTAAAAAGGGAATGTGG


A seguinte sequência corresponde ao mRNA da beta-globina:

ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAGGCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA


  *Compare as duas sequências (utilize o alinhamento blast online)*Que diferenças encontra e qual a sua origem?
A sequência de cima, correspondente ao DNA, é maior que a sequencia de baixo (correspondente ao RNA) pois para alem dos exões também contem os intrões. No RNA devido ao processo de splicing ha remoção dos intrões. Para alem disso o DNA também contem zonas não codificantes onde se encontra por exemplo o promotor. O RNA contem uma cauda poly-A que facilita a terminação da transcrição e o transporte do mRNA para fora do núcleo.


  *Onde se inicia a transcrição e porquê?

Ao alinharmos as duas sequências vemos que a transcrição inicia-se no nucleótido nº546(sequencia identica ao mRNA), e que esta está presente a mais ou menos 30 nucleotidos após a TATA box (que vai promover o inicio da transcrição)

  *Experimente traduzir ambas as sequências (tradução online). O que sucede e que implicações tem para o processo de expressão génica?

Ao tentar traduzir a partir da sequencia de DNA nao se obtem uma proteina pois esta ainda contem as zonas intronicas, o que faz com que os exoes não se encontram juntos para dar origem a proteina funcional. Logo, só faz sentido traduzir a sequencia de mRNA que já tenha sofrido o processo de splicing e portanto se encontre desprovida das zonas intronicas. os fragmentos de sequencia que se encontram antes e depois do codão iniciador e stop, respectivamente, sao denominados UTR (5' e 3'), e sao essenciais à regulação e a estabilização do transcrito.

  *Se estivesse a comparar a sequência de um gene de E. coli e seu transcrito, que diferenças esperaria encontrar? E se fosse de S. cerevisiae (levedura)?

As sequencias do DNA genomico e o seu respectivo transcrito, no caso da bacteria, possuem praticamente o mesmo tamanho e tambem sequências idênticas, pois nos procariotas não ocorre a remoção de intrões ou splicing, o que faz com que o mRNA é transcrito directamente a partir do DNA. No caso da levedura, que é um eucariota, existe o processo de splicing e portanto a remoção das zonas intrónicas. Este processo faz com que o transcrito na levedura seja menor em tamanho do que a sequência de DNA correspondente.

  * As bactérias e leveduras podem ser crescidas facilmente em grandes quantidades, o que permite a utilização destes organismos como "fábricas" de produção de proteínas. Se pretender utilizar estes organismos para produzir uma proteína humana, que aspectos terá de ter em consideração?

Ao utilizar uma bactéria, seria necessario introduzir uma sequencia desprovida de intrões, porque como j'a vimos anteriormente estas não utilisam o processo de splicing. Neste caso, utilisaria uma sequência de DNA complementar (cDNA), ou seja a copia da sequencia de mRNA da proteína humana e portanto sem a presença dos intrões. Para além disso também é necessario associa a molecula de cDNA um promotor que seja reconhecido pela bacteria de forma a que esta inicie a transcrição. Ao utilizar uma levedura, é possivel utilisar directamente a sequencia do gene que codifica a proteina humana pois como já vimosd anteriormente a levedura tem capacidede de remover as zonas intrónicas. De qualquer modo na levedura também é necessario associar à molécula um promotor que seja reconhecido pela maquinaria desta mesma.