User:Ana Claudia De O. Manata/Notebook/Aulas TP Bio Molecular/2010/04/27

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Digestão de DNA com enzimas de restrição

As enzimas de restrição são o bisturi dos biologistas moleculares pois permitem “cortar” o DNA de um modo preciso e reprodutível.

As enzimas de restrição fazem parte do grupo das nucleases, enzimas que clivam ligações fosfodiester entre nucleótidos adjacentes. As enzimas de restrição usadas em biologia molecular têm a grande vantagem de clivarem apenas as ligações entre nucleótidos com uma sequência específica. Existem comercializadas perto de 100 enzimas de restrição, cada uma das quais reconhece e cliva uma sequência única de nucleótidos.

As enzimas de restrição identificam-se por uma nomenclatura própria. Por exemplo, EcoRI refere-se à primeira (I) enzima isolada do género Escherichia (E). espécie coli (co), estirpe RY13 (R) e Hind III à terceira enzima (III) isolada de Haemophilus influenzae, estirpe Rd.

Exercício 1 – Extremidades e ligações

Considere as seguintes enzimas e respectivas sequências de restrição (o traço indica a ligação fosfodiéster que é clivada):

Bam HI : G|GATCC Hae II: GG|CC Eco RI: G|AATTC Bgl II: A|GATCT

  1. Que característica invulgar tem a sequência de reconhecimento destas enzimas?

São todas sequências palindrómicas.

  1. Represente as extremidades 5’ e 3’ de moléculas de DNA cortadas com cada uma destas enzimas.

Bam HI: ---------G GATCC---

       ---------CCTAG                    G---

Hae II: ---------GG CC---

       ---------CC                      GG---

Eco RI: ---------G AATTC---

       ---------CTTAA                    G---

Bgl II: ---------A GATCT---

       ---------TCTAG                    A---
  1. É possível ligar uma molécula de DNA com extremidades cortadas por Bam HI a outra com extremidades cortadas por: BamHI? Sim. EcoRI? Não. BglII? Sim.


  1. Em média, os fragmentos resultantes da digestão de DNA genómico humano com Bam HI serão maiores ou menores que os fragmentos resultantes de digestão com Hae II? Justifique.

Uma vez que a sequencia de reconhecimento da Bam HI é maior que a da Hae II e, assim, a probabilidade de um GGATCC ocorrer no genoma é menor que GGCC. Portanto, os fragmentos resultantes da digestão com Bam HI são maiores.


Exercício 2 – Mapas de restrição

As enzimas de restrição podem ser usadas para criar um mapa físico de uma molécula de DNA, reflectindo a sequência subjacente. Para isso, o fragmento de DNA a caracterizar é digerido com duas ou mais enzimas de restrição e analisado por electroforese em gel de agarose. Reveja os conceitos associados à electroforese em gel de agarose e veja um exemplo virtual da sua aplicação em http://www.vivo.colostate.edu/hbooks/genetics/biotech/gels/virgel.html

  1. A que correspondem as bandas azuis no gel?

Correspondem a corantes de electroforese. Permitem ver a colocação da amostra nos poços e seguir o desenvolvimento da electroforese.


  1. Considere a digestão do DNA plasmídeo pBR322 com PleI e BglI. Quantos fragmentos de DNA espera, e quantos consegue observar? Porquê?

Esperados: 4 para PleI; 3 para BgII Observados: 3 para PleI; 3 para BgII A gama de separação da electroforese é variável e não permite separar fragmentos com número próximo de nucleótidos.


  1. Que papel tem a concentração de agarose na análise de fragmentos de restrição?

A concentração de agarose está relacionada com o tamanho da malha do gel, logo com maior concentração de agarose é possível uma separação mais eficiente de fragmentos com menores diferenças de número de nucleótidos.


  1. Se pretendesse determinar de forma rigorosa o tamanho dos fragmentos de DNA observados na electroforese, como poderia fazê-lo?

Usando o marcador de pesos moleculares, procederia à realização de uma recta de calibração com o logaritmo do peso molecular dos fragmentos em função do tempo de retenção. Com o tempo de retenção dos fragmentos digeridos, conseguiria estimar o peso molecular de cada um deles.

BIOMOL LCS DadosTP6.jpg


Os produtos de digestão do genoma do bacteriófago lambda (de 48510 pares de bases) são muito utilizados como marcadores de tamanhos moleculares em electroforeses de DNA. A enzima EcoRI corta o genoma do fago em 5 locais: 21227, 26106, 31749, 39175, 44980. Considere o resultado de uma electroforese apresentado em cima.

  1. Poderá corresponder a uma digestão do DNA lambda com a enzima EcoRI ou não? Porquê?

Sim, uma vez que a enzima EcoRI corta o genoma do fago em 5 posições e no resultado da electroforese observam-se 6 bandas. Além disso, a distribuição das bandas no resultado da electroforese é consistente com os tamanhos dos fragmentos resultantes da acção de restrição da enzima EcoRI.


  1. Considerando que a quantidade total de DNA presente neste gel é de um micrograma, relativamente a cada uma das bandas observadas:
    1. Quantas moléculas de DNA estão na primeira e na última banda observadas no gel?

Ambas as bandas têm igual número de moléculas de DNA.

Considerando que o DNA lambda tem 31.6x10^5 daltons e que 1 dalton = 1.66x10^-27 gramas, o DNA lambda terá aproximadamente 10^-21 gramas = 10^-15 microgramas. Portanto, em 1 micrograma de DNA há aproximadamente 10^15 moléculas de DNA.


    1. Que quantidade de DNA está nas mesmas bandas?

Na primeira banda há 0.44 microgramas. Na última banda há 0.073 microgramas.


Considere um segmento de DNA de 10000 pares de bases (bps) e os fragmentos formados após digestão com as enzimas EcoRI e HindIII:

  1. DNA x EcoRI = 5000 + 3000 + 2000
  2. DNA x HindIII = 5500 + 4500
  3. DNA x EcoRI x HindIII = 5000 + 3000 + 1500 + 500
    1. Com base nesta informação, construa o mapa de restrição desta molécula.

nt0; nt5000 - Corte pela EcoRI; nt5500 - Corte pela HindIII; nt8000 - Corte pela EcoRI; nt10000.


Utilize o Webcutter ou o NEBcutter para gerar um mapa de restrição da sequência do cDNA da beta-globina e indique:

  1. uma enzima de corte único: BamHI;
  2. uma enzima com dois cortes: DpnI;
  3. uma enzima que não corta neste DNA: HindIII.

(ACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGTGCATCTGACTCCTGA GGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGGC AG|GCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGATG CTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGC TCACCTGGACAACCTCAAGGGCACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGAT CCTGAGAACTTCAG|GCTCCTGGGCAACGTGCTGGTCTGTGTGCTGGCCCATCACTTTGGCAAAGAATTCA CCCCACCAGTGCAGGCTGCCTATCAGAAAGTGGTGGCTGGTGTGGCTAATGCCCTGGCCCACAAGTATCA CTAAGCTCGCTTTCTTGCTGTCCAATTTCTATTAAAGGTTCCTTTGTTCCCTAAGTCCAACTACTAAACT GGGGGATATTATGAAGGGCCTTGAGCATCTGGATTCTGCCTAATAAAAAACATTTATTTTCATTGCAAAA AAAAAAAAA)

Exercício 3 – Enzimas de restrição, RFLPs (Restriction Fragment Length Polymorphisms) e diagnóstico de mutações

As variações de sequência do genoma humano podem resultar na alteração de locais de corte de enzimas de restrição. As bandas polimórficas observadas após a electroforese de amostras de DNA genómico após tratamento com enzimas de restrição (RFLPs) constituíram o primeiro método laboratorial de “impressões digitais” de DNA para identificação de indivíduos em Medicina legal e forense.

Da mesma forma, mutações causadoras de doença podem gerar variações nos locais de corte de enzimas de restrição que permitem um fácil diagnóstico da sua presença.

O gene humano que codifica a beta-globina possui 3 locais de restrição DdeI. A distância entre o primeiro e o segundo local é de 175 bp. A distância entre o segundo e o terceiro local é de 201 bp. Em indivíduos com anemia de células falciformes ocorre uma mutação que anula o segundo local de restrição DdeI.

  1. Represente esquematicamente o gene normal e o gene mutado, indicando as posições relativas dos 3 locais DdeI.

Ddel-1_______________Ddel-2_____________________Ddel-3 (gene normal)

#|________________X______________________| (gene mutado)


  1. Proponha um procedimento para diagnóstico desta mutação com base na técnica de PCR.

Utilizando a técnica de PCR é possível amplificar o DNA em questão. Após o PCR procederia a um tratamento do DNA com a enzima de restrição DdeI, seguido de electroforese.


  1. Represente esquematicamente os resultados que espera observar ao analisar um indivíduo saudável, um portador da mutação (heterozigótico) e um doente (homozigótico).

Indivíduo saudável: 2 bandas; Portador: 3 bandas; Doente: 1 banda.