User:Ana Claudia De O. Manata/Notebook/Aulas TP Bio Molecular/2010/03/16

From OpenWetWare
Jump to: navigation, search
Owwnotebook icon.png Project name Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Sequenciação de DNA

Introdução

As sequências de genes e mRNAs com que temos vindo a trabalhar foram obtidas experimentalmente com base na técnica de sequênciação de DNA desenvolvida nos anos 70 por Fred Sanger.

A seguinte animação explica o funcionamento da técnica: Sanger sequencing

Actualmente utiliza-se uma versao mais moderna que recorre a DNA polimerases termoestáveis e nucleótidos fluorescentes, permitindo maior sensibilidade e a leitura automática do resultado da sequênciação: Cycle sequencing

Note que o resultado de uma sequenciação é um electroferograma, que depois é convertido em "As, Cs, Gs e Ts" por um programa informático.


Questões

  • O que é necessário para fazer uma reacção de sequenciação?

É necessária a cadeia de DNA a sequenciar (DNA template), um primer (complementar à sequência de DNA a sequenciar), a DNA polimerase e os 4 desoxinucleótidos - dNTP (A, G, T, C). Ao mix também são adicionados outro tipo de nucleótidos, os didesoxinucleótidos (ddNTP).


  • Que cadeia é sequenciada?

As cadeias obtidas (com diferenters comprimentos), aquando da sequenciação, são iguais a porções da cadeia que se quer sequenciar, porque são obtidas a partir de um primer complementar à cadeia molde.


  • Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?

A síntese da cadeia não é continuada indefinitivamente pois na mistura existem pequenas quantidades de ddNTP que bloqueiam a elongação. Isto deve-se ao facto dos ddNTP terem um átomo de Hidrogénio ligado ao carbono 3', em vez do grupo hidroxilo.


  • Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?

A quantidade de dNTP é bastante maior que a de ddNTP, o que leva a uma incorporação probablística com vantagem dos dNTP, obtendo-se cadeias de diferentes comprimentos e com um número considerável de nucleótidos.



  • Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?

2010 TP2 1.jpg

Podem haver problemas tanto ao nível da polimerização como ao nível da resolução da electroforese.

A capacidade de polimerizar fragmentos com mais de 350/400 nucleótidos é reduzida, o que é observado no electroferograma pela fraca intensidade dos picos. Além disto, os picos correspondentes aos fragmentos de menor e maior comprimento não têm uma boa resolução porque na electroforese não são devidamente separados.


  • O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?

Adicionando diferentes primers complementares a diferentes distâncias da cadeia. Quando na sequência estão porções desconhecidas, utiliza-se o final de uma cadeia polimerizada anteriormente para a construção do primer.


  • Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?

2010 TP2 2.jpg

T Vermelho A Verde G Preto C Azul

Indivíduo 1: TCGTGTTCTATGATCATGAGAGTCGCCG Indivíduo 2: TCGTGTTCTATGAT(C/G)ATGAGAGTCGCCG, heterozigotia.


  • Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder?

Para sequenciar o gene recorre-se a um procedimento semelhante ao analisado. Quanto à amostra recolhida, esta poderá ser de qualquer tecido uma vez que todas as células têm no genoma este gene. Para sequenciar o mRNA será necessário obter cDNA, uma vez que só este pode ser sequenciado, e fornecer primers complementares ao mesmo. Quanto à amostra biológica, o mais fácil será recolher uma amostra de sangue que contém as células que expressam o gene em questão.


  • Considere os resultados da sequenciação discutida no Caso de Estudo 1.
  1. 1. Que aspecto esperaria encontrar no electroferograma na região variável de cada indivíduo?

Considerando as mutações T->A ao nível do nucleótido 462 (mãe) e T->G ao nível do nucleótido 732 (pai): MÃE - O pico correspondente ao nucleótido 462 teria uma sobreposição de vermelho e verde; o pico correspondente ao nucleótido 732 seria vermelho. PAI - O pico correspondente ao nucleótido 732 teria uma sobreposição de vermelho e preto; o pico correspondente ao nucleótido 462 seria vermelho. DOENTE(Maria) - O pico correspondente ao nucleótido 462 teria uma sobreposição de vermelho e verde; o pico correspondente ao nucleótido 732 teria uma sobreposição vermelho e preto.

  1. 2. Se tivesse apenas acesso aos resultados da sequenciação da Maria, seria capaz de definir o seu genótipo com rigor? Justifique.

Não. Os resultados da sequenciação, em isolado, não informam se há mutações que originem a doença. Possibilidade de diferentes mutações em nucleótidos diferentes, existentes em alelos diferentes, cuja presença em simultâneo é que dá origem a patologia.


  • Com base na sequência do gene da beta-globina disponível na última TP e as técnicas de análise de sequências que tem vindo a aprender identifique as regiões do gene em que se localizam as alterações pontuais encontradas.

Fazendo o alinhamento da sequência do gene e do mRNA obtido, utilizando o BLAST e tendo em atenção qual o 1º nucleótido a ser transcrito, a mutação no nucleótido 462 corresponde a uma zona codificante do genoma e tem como consequência a uma proteína truncada, enquanto que a mutação no nucleótido 732 corresponde a uma zona não codificante do genoma, em particular uma região de regulação de splicing.

Para pensar

  • Se a sequenciação obriga ao conhecimento prévio de um pequeno pedaço de sequência, como foi possível efectuar as primeiras sequenciações?

Recorrendo a um método que permite clivar moléculas radioactivas de DNA ao nível dos diferentes nucleótidos (Maxam & Gilber). A clivagem diferencial dos nucleótidos é efectuada em 4 reacções diferentes, utilizando diferentes químicos (cada um específico para uma base) obtendo-se, portanto, segmentos de DNA clivados. Como, virtualmente, cada segmento termina numa base diferente é possível deduzir a totalidade da sequência através da análise do perfil das bandas radioactivas num gel de electroforese (onde 4 poços do gel seriam utilizados, um para cada reacção de clivagem). A sequenciação de DNA através deste método não necessita de conhecimento prévio de partes da sequência, pois o mecanismo não é baseado na síntese de DNA em que é necessário o design de primers a partir do conhecimento de certos segmentos.


  • Que estratégias terão sido usadas para sequenciar os milhões de nucleótidos dos vários cromossomas do genoma humano?

Uma das estratégias consiste em clivar o genoma inteiro em sequências de menores dimensões, uma vez que todos os métodos de sequenciação utilizados têm um limite de número máximo de pares de bases, e clonar cada uma dessas sequências em BACs (Bacterial Artificial Chromosomes), que por sua vez são trasnferidos para células de um vector celular (e.g. E.coli). Obtém-se assim uma biblioteca genómica à qual se recorre para sequenciar individualmente cada segmento.