User:Alexander S Mikheyev/Notebook/rotifer alien genes/2010/03/29

From OpenWetWare
Jump to: navigation, search
OpenWetWare photo.jpg Alien genes Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

Testing Lea primers

  • These were designed off A. ricciae sequence with the goal of amplifying all four copies of the gene

Lea primer sequences

Lea1F CGACAGTGCTACTTTCGTAAAAGAT
Lea1R ACAGCTGGTTTAATTGCATCC
Lea2F GAAGCTTCACTTGAAACAGCAG
Lea2R AATTCAGTAGCTTGTCGTTTCTTTT

Reaction conditions

Reaction mixture conc. 1x 4
water 7.25 29
TopTaq buffer 10x 1 4
dNTP mix 10 mM each 0.2 0.8
Primer mix 5 uM each 0.5
TopTaq (QIAGEN) 5U/ul 0.05 0.2
template 20 ng/ul 0.5 -
8.5
  • 95C 3min (60C 1 min, 95C 5s)x35

Gel

Blank! Tried the reaction a second time, and it also did not work, for A. vaga or A. ricciae

HCO LCO Screening

Reaction mixture conc. 1x 50 '
Template Instagene ? 1
TopTaq buffer 10x 1 50
dNTP mix 10 mM each 0.2 10
Primer mix 5 uM each 0.5 25
TopTaq (QIAGEN) 5U/ul 0.05 2.5
Milli Q water 7.25 362.5
10 ul 450 9.0ul / RXN
*Control AV 1ng/ul
PCR cycle
94C 3 min
94C 10 sec
45-68C 3 min
RAMP 0.5C/sec
x35
68C 5 min
AMP Lane Template '
1 Ithaca 1 A6
2 Ithaca 1 B1
3 Ithaca 1 B3
4 Ithaca 1 B5
5 Ithaca 1 C1
6 Ithaca 1 D1
7 Ithaca 1 D3
8 Ithaca 1 D4
9 Ithaca 1 D6
10 Ithaca 2 A1
11 Ithaca 2 A2
12 Ithaca 2 A3
13 Ithaca 2 A4
14 Ithaca 2 A5
15 Pennsylvania (PA) B4
16 Tsukuba 1 A4
17 Tsukuba 1 A6
18 Tsukuba 1 B2
19 Tsukuba 1 B4
20 Tsukuba 1 C1
21 Tsukuba 1 C6
22 Tsukuba 3 D2
23 Tsukuba 3 D3
24 Tsukuba 3 D4
25 Woods Hole 1 A6
26 Woods Hole 1 C2
27 Woods Hole 1 C3
28 Yokohama B5
29 Baltimore A3
30 Baltimore A6
31 E. Windsor D4
32 Harvard A1
33 Ithaca 2 A6
34 Pennsylvania (PA) D4
35 Tsukuba 1 B5
36 Yokohama A2
37 Baltimore C1
38 Ithaca 1 A4
39 Pennsylvania (PA) B6
40 Yokohama B2
41 Yokohama A4
42 Ithaca 1 C4
43 Ithaca 1 D5
44 Baltimore C5
45 E. Windsor A2
46 Pennsylvania (PA) B3
47 Ithaca 1 C3
48 Positive Control AV


Load 1.0ul sample 30march10.jpg

Alien Gene LongPCR

Amplification of TEL_L_A : new primer screen

Reaction mixture conc. 1x 5
*Template 1ng/ul 1 5
TopTaq buffer 10x 1 5
dNTP mix 10 mM each 0.2 1
Primer mix 5 uM each 1
TopTaq (QIAGEN) 5U/ul 0.05 0.25
Milli Q water 6.75 33.75
10 ul 45
*CCA3 or AV 9.0ul/RXN
PCR cycle
94C 3 min
98C 10 sec
60C 3 min
x35
72C 5 min
AMP Lane Template Contents
A AV AV10083
B AV AV10084.2
C AV AV10085
D AV AV10090
E CCA3 AV10083
F CCA3 AV10084.2
G CCA3 AV10085
H CCA3 AV10090

Evaporation in some wells - Re-Amp

Amplification of TEL_L_B

' [CONC] 1X 20 '
Water 5.3 106
Takara LA Taq 5U 0.1 2
Takara LA Buffer 10X 1 20
dNTP 2.5uM each 1.6 32
*Template 1ng 1 20
Primer Mix 5uM each 1
10.0ul 180 9.0ul/RXN
add 1.0 Primer Mix
* AV or CCA3
PCR Cycle
94C 1 min
98C 10 sec
65C 15 min
30X
AMP Lane Template MIX Contents ' Size Fosmid
1 AV TEL_L_B_1 TEL_L_B_1 AV TEL L B
2 AV TEL_L_B_2 TEL_L_B_2 AV TEL L B
3 AV TEL_L_B_3 TEL_L_B_3 AV TEL L B
4 AV TEL_L_B_4 TEL_L_B_4 AV TEL L B
5 AV 109 AV10106 FWD AV10107 RVS AV TEL L B
6 AV 110 AV10106 FWD AV10107.2 RVS AV TEL L B
7 AV 111 AV10106 FWD AV10108.2 RVS AV TEL L B
8 AV 112 AV10107.1 FWD AV10108 RVS AV TEL L B
9 AV 113 AV10107.1 FWD AV10108.2 RVS AV TEL L B
10 AV 114 AV10107.2 FWD AV10108 RVS AV TEL L B
11 AV 115 AV10107.2 FWD AV10108.2 RVS AV TEL L B
12 AV 116 AV10111 FWD AV10112 RVS AV TEL L B
13 AV 117 AV10111 FWD AV10113 RVS AV TEL L B
14 AV 118 AV10111.2 FWD AV10112 RVS AV TEL L B
15 AV 119 AV10111.2 FWD AV10113 RVS AV TEL L B
16 AV 120 AV10112 FWD AV114 RVS AV TEL L B
17 AV 121 AV10113 FWD AV114 RVS AV TEL L B
18 AV 122 AV108.2 FWD AV114 RVS AV TEL L B
19 CCA3 TEL_L_B_1 TEL_L_B_1 AV TEL L B
20 CCA3 TEL_L_B_2 TEL_L_B_2 AV TEL L B
21 CCA3 TEL_L_B_3 TEL_L_B_3 AV TEL L B
22 CCA3 TEL_L_B_4 TEL_L_B_4 AV TEL L B
23 CCA3 109 AV10106 FWD AV10107 RVS AV TEL L B
24 CCA3 110 AV10106 FWD AV10107.2 RVS AV TEL L B
25 CCA3 111 AV10106 FWD AV10108.2 RVS AV TEL L B
26 CCA3 112 AV10107.1 FWD AV10108 RVS AV TEL L B
27 CCA3 113 AV10107.1 FWD AV10108.2 RVS AV TEL L B
28 CCA3 114 AV10107.2 FWD AV10108 RVS AV TEL L B
29 CCA3 115 AV10107.2 FWD AV10108.2 RVS AV TEL L B
30 CCA3 116 AV10111 FWD AV10112 RVS AV TEL L B
31 CCA3 117 AV10111 FWD AV10113 RVS AV TEL L B
32 CCA3 118 AV10111.2 FWD AV10112 RVS AV TEL L B
33 CCA3 119 AV10111.2 FWD AV10113 RVS AV TEL L B
34 CCA3 120 AV10112 FWD AV114 RVS AV TEL L B
35 CCA3 121 AV10113 FWD AV114 RVS AV TEL L B
36 CCA3 122 AV108.2 FWD AV114 RVS AV TEL L B

Load 1.0ul sample 29march10 gel 1.jpg

Load 1.0ul sample 29march10 gel 2.jpg