User:Alexander S Mikheyev/Notebook/rotifer alien genes/2010/03/26

From OpenWetWare
Jump to: navigation, search
OpenWetWare photo.jpg Alien genes Report.pngMain project page
Resultset previous.pngPrevious entry      Next entryResultset next.png

HCO LCO Screening

Test Ramp PCR on Cultured samples 1-7

Reaction mixture conc. 1x 10 '
Template Instagene ? 1
TopTaq buffer 10x 1 10
dNTP mix 10 mM each 0.2 2
Primer mix 5 uM each 1 10
TopTaq (QIAGEN) 5U/ul 0.05 0.5
Milli Q water 6.75 67.5
10 ul 90 9.0ul / RXN
*Control AV 1ng/ul
PCR cycle
94C 3 min
94C 10 sec
45-68C 3 min
RAMP 0.5C/sec
x35
68C 5 min
AMP Lane Template '
1 Baltimore A1
2 Baltimore B1
3 Baltimore C2
4 Baltimore C3
5 E. Windsor A1
6 E. Windsor A3
7 E. Windsor B1
8 AV Positive Control

Load 1.0ul sample 26mar10 LCO HCO.jpg

Alien Genes New Primer Screen

Reaction mixture conc. 1x x32.5 ' Lane Gene Lane Gene
Temp (E. Windsor C3, 70) ?? 2 65 1 AV10158 17 AV10084
TopTaq Buffer 10x 1 32.5 2 AV10153 18 AV10082
dNTP mix 10 mM each 0.2 6.5 3 AV10151 19 AV10075
Primer mix 5 uM each 1 4 AV10150 20 AV10071
TopTaq 5 U/ul 0.05 1.625 5 AV10140 21 AV10045
Milli Q 5.75 186.875 6 AV10134 22 AV10043
10 ul 7 AV10130 23 AV10042
8 AV10123 24 AV10041
PCR cycle 9 AV10121 25 AV10034
94C 3 min 10 AV10104 26 AV10028
11 AV10109 27 AV10027
98C 10 sec 12 AV10099 28 AV10025
60C 3 min 13 AV10098 29 AV10016
x35 14 AV10094 30 AV10011
15 AV10092 31 AV10007
72C 5 min 16 AV10089 32 AV10002
Reaction mixture conc. 1x x16.5 No. Sample Lane Gene
Temp (73, 74) ?? 2 33 73 Ithaca 1 C2 1 AV10134
TopTaq Buffer 10x 1 16.5 74 Pennsylvania (PA) D5 2 AV10121
dNTP mix 10 mM each 0.2 3.3 3 AV10084
Primer mix 5 uM each 1 4 AV10045
TopTaq 5 U/ul 0.05 0.825 5 AV10044
Milli Q 5.75 94.875 6 AV10034
10 ul 7 AV10027
8 AV10025
PCR cycle
94C 3 min
98C 10 sec
60C 3 min
x35
72C 5 min

Loaded 2.0ul of each sample

0050-1.jpg

Testing new primers on ricciae and vaga

These primers were designed to amplify all four copies of the gene, using data from A. vaga and P. roseola.

Reaction mixture conc. 1x 21
water 7.25 152.25
TopTaq buffer 10x 1 21
dNTP mix 10 mM each 0.2 4.2
Primer mix 5 uM each 0.5
TopTaq (QIAGEN) 5U/ul 0.05 1.05
template 20 ng/ul 0.5 -
8.5
  • PCR conditions 95C 3m (93C 5s;60C 1m)x35

Primer sequences

hsp82_f1 TCAATACATTTTACYCGAACAAAGAAA
hsp82_r1 ATTCCCAAACATATTGTTCATCATC
hsp82_f2 TTATATGACTGAACCAATCGATGAA
hsp82_r2 TAGTAGCTGACCAACCATATTGTGA
myosin_f1 TTGATGAAGCTAAACAAGTCTTCG
myosin_r1 TCAAGTTTTTCAGCCATAGCAAC
myosin_f2 CCCAGTGATAAAGTTGATGAAGCTA
myosin_r2 TCAAGTTTTTCAGCCATAGCAAC
PMCA_f1 GTATTGCAAAATTTCTTCAATTTCA
PMCA_r1 ATCGATTTTGTWCGWCCNTA
saicars_f1 CRAAAATGTACAATGATWCCWATTC
saicars_f2 ACCATCCANARATGTTCGAG
rho_f1 GCTAAATTATCYGYATCCATTTTTG
rho_r1 AATATGGTTCAACATTTGTTGGTTT
s15a_f1 GAAAAACGYCACAAACGTCAAGT
s15a_r1 TGGTAAAAGATTATTAGTCCAAGTT
histone_f1 ACCTTTACCACCTTTACCACGTC
histone_r1 GTCGATTTTTGATAACGACGAATTT
histone_f2 TTTTCAAGAAAGATTTTRAGAACACC
histone_r2 GTAATTCRGTCGATTTTTGATAACG

Gel

  • Unless specified, the order of the sapmles is ricciae then vaga
  • all of the primers worked, except sacairs and a15, which did not cross-amplify
  • maybe should also try them on Philodena?
Asm100526.png