User:Alexander S Mikheyev/Notebook/rotifer alien genes/2010/03/26

Alien genes

Main project page Previous entry      Next entry

HCO LCO Screening Test Ramp PCR on Cultured samples 1-7 Reaction mixture conc. 1x 10 ' Template Instagene ? 1 TopTaq buffer 10x 1 10 dNTP mix 10 mM each 0.2 2 Primer mix 5 uM each 1 10 TopTaq (QIAGEN) 5U/ul 0.05 0.5 Milli Q water 6.75 67.5 10 ul 90 9.0ul / RXN *Control AV 1ng/ul PCR cycle 94C 3 min 94C 10 sec 45-68C 3 min RAMP 0.5C/sec x35 68C 5 min AMP Lane Template ' 1 Baltimore A1 2 Baltimore B1 3 Baltimore C2 4 Baltimore C3 5 E. Windsor A1 6 E. Windsor A3 7 E. Windsor B1 8 AV Positive Control Load 1.0ul sample Alien Genes New Primer Screen Reaction mixture conc. 1x x32.5 ' Lane Gene Lane Gene Temp (E. Windsor C3, 70) ?? 2 65 1 AV10158 17 AV10084 TopTaq Buffer 10x 1 32.5 2 AV10153 18 AV10082 dNTP mix 10 mM each 0.2 6.5 3 AV10151 19 AV10075 Primer mix 5 uM each 1 4 AV10150 20 AV10071 TopTaq 5 U/ul 0.05 1.625 5 AV10140 21 AV10045 Milli Q 5.75 186.875 6 AV10134 22 AV10043 10 ul 7 AV10130 23 AV10042 8 AV10123 24 AV10041 PCR cycle 9 AV10121 25 AV10034 94C 3 min 10 AV10104 26 AV10028 11 AV10109 27 AV10027 98C 10 sec 12 AV10099 28 AV10025 60C 3 min 13 AV10098 29 AV10016 x35 14 AV10094 30 AV10011 15 AV10092 31 AV10007 72C 5 min 16 AV10089 32 AV10002 Reaction mixture conc. 1x x16.5 No. Sample Lane Gene Temp (73, 74) ?? 2 33 73 Ithaca 1 C2 1 AV10134 TopTaq Buffer 10x 1 16.5 74 Pennsylvania (PA) D5 2 AV10121 dNTP mix 10 mM each 0.2 3.3 3 AV10084 Primer mix 5 uM each 1 4 AV10045 TopTaq 5 U/ul 0.05 0.825 5 AV10044 Milli Q 5.75 94.875 6 AV10034 10 ul 7 AV10027 8 AV10025 PCR cycle 94C 3 min 98C 10 sec 60C 3 min x35 72C 5 min Loaded 2.0ul of each sample Testing new primers on ricciae and vaga These primers were designed to amplify all four copies of the gene, using data from A. vaga and P. roseola. Reaction mixture conc. 1x 21 water 7.25 152.25 TopTaq buffer 10x 1 21 dNTP mix 10 mM each 0.2 4.2 Primer mix 5 uM each 0.5 TopTaq (QIAGEN) 5U/ul 0.05 1.05 template 20 ng/ul 0.5 - 8.5 PCR conditions 95C 3m (93C 5s;60C 1m)x35 Primer sequences hsp82_f1 TCAATACATTTTACYCGAACAAAGAAA hsp82_r1 ATTCCCAAACATATTGTTCATCATC hsp82_f2 TTATATGACTGAACCAATCGATGAA hsp82_r2 TAGTAGCTGACCAACCATATTGTGA myosin_f1 TTGATGAAGCTAAACAAGTCTTCG myosin_r1 TCAAGTTTTTCAGCCATAGCAAC myosin_f2 CCCAGTGATAAAGTTGATGAAGCTA myosin_r2 TCAAGTTTTTCAGCCATAGCAAC PMCA_f1 GTATTGCAAAATTTCTTCAATTTCA PMCA_r1 ATCGATTTTGTWCGWCCNTA saicars_f1 CRAAAATGTACAATGATWCCWATTC saicars_f2 ACCATCCANARATGTTCGAG rho_f1 GCTAAATTATCYGYATCCATTTTTG rho_r1 AATATGGTTCAACATTTGTTGGTTT s15a_f1 GAAAAACGYCACAAACGTCAAGT s15a_r1 TGGTAAAAGATTATTAGTCCAAGTT histone_f1 ACCTTTACCACCTTTACCACGTC histone_r1 GTCGATTTTTGATAACGACGAATTT histone_f2 TTTTCAAGAAAGATTTTRAGAACACC histone_r2 GTAATTCRGTCGATTTTTGATAACG Gel Unless specified, the order of the sapmles is ricciae then vaga all of the primers worked, except sacairs and a15, which did not cross-amplify maybe should also try them on Philodena?